ID: 943786342

View in Genome Browser
Species Human (GRCh38)
Location 2:191882068-191882090
Sequence CTTGAACTTCTCCTCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943786339_943786342 -10 Left 943786339 2:191882055-191882077 CCTCGGCGATCTCCTTGAACTTC 0: 1
1: 1
2: 0
3: 17
4: 106
Right 943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG No data
943786338_943786342 -1 Left 943786338 2:191882046-191882068 CCTCATAGGCCTCGGCGATCTCC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943786342 Original CRISPR CTTGAACTTCTCCTCGGCGC CGG Intergenic
No off target data available for this crispr