ID: 943786857

View in Genome Browser
Species Human (GRCh38)
Location 2:191886778-191886800
Sequence CTGCATGAAGAGAGGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943786853_943786857 8 Left 943786853 2:191886747-191886769 CCTAGTACAAACATGAAATACAT No data
Right 943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943786857 Original CRISPR CTGCATGAAGAGAGGCAGAA AGG Intergenic
No off target data available for this crispr