ID: 943786863

View in Genome Browser
Species Human (GRCh38)
Location 2:191886884-191886906
Sequence TTGTGGCAGTACAAGGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943786860_943786863 23 Left 943786860 2:191886838-191886860 CCAAAGAGGACAAGAGGCTTTTA No data
Right 943786863 2:191886884-191886906 TTGTGGCAGTACAAGGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943786863 Original CRISPR TTGTGGCAGTACAAGGTCAA TGG Intergenic
No off target data available for this crispr