ID: 943790621

View in Genome Browser
Species Human (GRCh38)
Location 2:191928312-191928334
Sequence CTGTGGCTACAGAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943790621_943790627 3 Left 943790621 2:191928312-191928334 CCAACTTCCTTCTGTAGCCACAG No data
Right 943790627 2:191928338-191928360 AGCCTTGTGGGCAGTTGTTAAGG No data
943790621_943790624 -9 Left 943790621 2:191928312-191928334 CCAACTTCCTTCTGTAGCCACAG No data
Right 943790624 2:191928326-191928348 TAGCCACAGACCAGCCTTGTGGG No data
943790621_943790623 -10 Left 943790621 2:191928312-191928334 CCAACTTCCTTCTGTAGCCACAG No data
Right 943790623 2:191928325-191928347 GTAGCCACAGACCAGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943790621 Original CRISPR CTGTGGCTACAGAAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr