ID: 943791848

View in Genome Browser
Species Human (GRCh38)
Location 2:191942068-191942090
Sequence CTGTGTGACTGTAATTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943791843_943791848 -7 Left 943791843 2:191942052-191942074 CCTTCTCCCTTAATCCCTGTGTG No data
Right 943791848 2:191942068-191942090 CTGTGTGACTGTAATTAAGCAGG No data
943791841_943791848 -5 Left 943791841 2:191942050-191942072 CCCCTTCTCCCTTAATCCCTGTG No data
Right 943791848 2:191942068-191942090 CTGTGTGACTGTAATTAAGCAGG No data
943791842_943791848 -6 Left 943791842 2:191942051-191942073 CCCTTCTCCCTTAATCCCTGTGT No data
Right 943791848 2:191942068-191942090 CTGTGTGACTGTAATTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943791848 Original CRISPR CTGTGTGACTGTAATTAAGC AGG Intergenic
No off target data available for this crispr