ID: 943794959

View in Genome Browser
Species Human (GRCh38)
Location 2:191980693-191980715
Sequence CTGGAGGTCTGGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943794959_943794964 30 Left 943794959 2:191980693-191980715 CCCTCTTCTCTCCAGACCTCCAG No data
Right 943794964 2:191980746-191980768 AAATGAACATATTCATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943794959 Original CRISPR CTGGAGGTCTGGAGAGAAGA GGG (reversed) Intronic
No off target data available for this crispr