ID: 943799045

View in Genome Browser
Species Human (GRCh38)
Location 2:192034848-192034870
Sequence TGCCCTATCCTGCTTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943799040_943799045 16 Left 943799040 2:192034809-192034831 CCAGCCAGTCTGAGGCATTTTCC No data
Right 943799045 2:192034848-192034870 TGCCCTATCCTGCTTTTCACTGG No data
943799043_943799045 -5 Left 943799043 2:192034830-192034852 CCATCATCCTGAAGGAGTTGCCC No data
Right 943799045 2:192034848-192034870 TGCCCTATCCTGCTTTTCACTGG No data
943799041_943799045 12 Left 943799041 2:192034813-192034835 CCAGTCTGAGGCATTTTCCATCA No data
Right 943799045 2:192034848-192034870 TGCCCTATCCTGCTTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943799045 Original CRISPR TGCCCTATCCTGCTTTTCAC TGG Intronic
No off target data available for this crispr