ID: 943799891

View in Genome Browser
Species Human (GRCh38)
Location 2:192044749-192044771
Sequence AGTTATCCACAGAAGATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943799891_943799893 15 Left 943799891 2:192044749-192044771 CCTGATATCTTCTGTGGATAACT No data
Right 943799893 2:192044787-192044809 AACAGTTCTTAGTTTGCTACTGG No data
943799891_943799894 16 Left 943799891 2:192044749-192044771 CCTGATATCTTCTGTGGATAACT No data
Right 943799894 2:192044788-192044810 ACAGTTCTTAGTTTGCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943799891 Original CRISPR AGTTATCCACAGAAGATATC AGG (reversed) Intronic
No off target data available for this crispr