ID: 943799891 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:192044749-192044771 |
| Sequence | AGTTATCCACAGAAGATATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943799891_943799893 | 15 | Left | 943799891 | 2:192044749-192044771 | CCTGATATCTTCTGTGGATAACT | No data | ||
| Right | 943799893 | 2:192044787-192044809 | AACAGTTCTTAGTTTGCTACTGG | No data | ||||
| 943799891_943799894 | 16 | Left | 943799891 | 2:192044749-192044771 | CCTGATATCTTCTGTGGATAACT | No data | ||
| Right | 943799894 | 2:192044788-192044810 | ACAGTTCTTAGTTTGCTACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943799891 | Original CRISPR | AGTTATCCACAGAAGATATC AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||