ID: 943799931

View in Genome Browser
Species Human (GRCh38)
Location 2:192045155-192045177
Sequence TACAGCTACCACCTGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943799929_943799931 5 Left 943799929 2:192045127-192045149 CCTGATTTACAGAAGATTCTGCA No data
Right 943799931 2:192045155-192045177 TACAGCTACCACCTGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943799931 Original CRISPR TACAGCTACCACCTGAAAGT GGG Intronic
No off target data available for this crispr