ID: 943801926

View in Genome Browser
Species Human (GRCh38)
Location 2:192071049-192071071
Sequence CTTTGAATAAGTAAGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943801921_943801926 -7 Left 943801921 2:192071033-192071055 CCCTACTGAGCGAATGCTTTGAA No data
Right 943801926 2:192071049-192071071 CTTTGAATAAGTAAGGGAGGAGG No data
943801920_943801926 10 Left 943801920 2:192071016-192071038 CCTGAAGAGCACTCTTTCCCTAC No data
Right 943801926 2:192071049-192071071 CTTTGAATAAGTAAGGGAGGAGG No data
943801922_943801926 -8 Left 943801922 2:192071034-192071056 CCTACTGAGCGAATGCTTTGAAT No data
Right 943801926 2:192071049-192071071 CTTTGAATAAGTAAGGGAGGAGG No data
943801919_943801926 11 Left 943801919 2:192071015-192071037 CCCTGAAGAGCACTCTTTCCCTA No data
Right 943801926 2:192071049-192071071 CTTTGAATAAGTAAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943801926 Original CRISPR CTTTGAATAAGTAAGGGAGG AGG Intronic
No off target data available for this crispr