ID: 943804461

View in Genome Browser
Species Human (GRCh38)
Location 2:192105701-192105723
Sequence TTTTGGAATTAGTTTTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943804461_943804465 8 Left 943804461 2:192105701-192105723 CCATAATAAAACTAATTCCAAAA No data
Right 943804465 2:192105732-192105754 CAGAAAATGGAAGGTAAAAAAGG No data
943804461_943804463 -5 Left 943804461 2:192105701-192105723 CCATAATAAAACTAATTCCAAAA No data
Right 943804463 2:192105719-192105741 CAAAACATATATGCAGAAAATGG No data
943804461_943804464 -1 Left 943804461 2:192105701-192105723 CCATAATAAAACTAATTCCAAAA No data
Right 943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943804461 Original CRISPR TTTTGGAATTAGTTTTATTA TGG (reversed) Intronic
No off target data available for this crispr