ID: 943804464

View in Genome Browser
Species Human (GRCh38)
Location 2:192105723-192105745
Sequence ACATATATGCAGAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943804461_943804464 -1 Left 943804461 2:192105701-192105723 CCATAATAAAACTAATTCCAAAA No data
Right 943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG No data
943804460_943804464 10 Left 943804460 2:192105690-192105712 CCATTCATGTGCCATAATAAAAC No data
Right 943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943804464 Original CRISPR ACATATATGCAGAAAATGGA AGG Intronic
No off target data available for this crispr