ID: 943805730

View in Genome Browser
Species Human (GRCh38)
Location 2:192122903-192122925
Sequence ATGCTTCCTAATTGCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943805730_943805732 21 Left 943805730 2:192122903-192122925 CCAGAAATGCAATTAGGAAGCAT No data
Right 943805732 2:192122947-192122969 AATAACAAGGCACACAACTTTGG No data
943805730_943805731 8 Left 943805730 2:192122903-192122925 CCAGAAATGCAATTAGGAAGCAT No data
Right 943805731 2:192122934-192122956 ATGTATTTGTAATAATAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943805730 Original CRISPR ATGCTTCCTAATTGCATTTC TGG (reversed) Intronic
No off target data available for this crispr