ID: 943806010

View in Genome Browser
Species Human (GRCh38)
Location 2:192127093-192127115
Sequence CTGTCAGAAAGCCTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943806010_943806014 -9 Left 943806010 2:192127093-192127115 CCCTCCACCAGGCTTTCTGACAG No data
Right 943806014 2:192127107-192127129 TTCTGACAGATGAGAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943806010 Original CRISPR CTGTCAGAAAGCCTGGTGGA GGG (reversed) Intronic
No off target data available for this crispr