ID: 943809259

View in Genome Browser
Species Human (GRCh38)
Location 2:192163846-192163868
Sequence CGCAAAGAAGGATATGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943809259_943809263 22 Left 943809259 2:192163846-192163868 CCTTTTCCATATCCTTCTTTGCG No data
Right 943809263 2:192163891-192163913 ACACCAATAACAATATAGAAAGG No data
943809259_943809265 27 Left 943809259 2:192163846-192163868 CCTTTTCCATATCCTTCTTTGCG No data
Right 943809265 2:192163896-192163918 AATAACAATATAGAAAGGAATGG No data
943809259_943809266 28 Left 943809259 2:192163846-192163868 CCTTTTCCATATCCTTCTTTGCG No data
Right 943809266 2:192163897-192163919 ATAACAATATAGAAAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943809259 Original CRISPR CGCAAAGAAGGATATGGAAA AGG (reversed) Intronic