ID: 943809261

View in Genome Browser
Species Human (GRCh38)
Location 2:192163852-192163874
Sequence TGCCAACGCAAAGAAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943809261_943809266 22 Left 943809261 2:192163852-192163874 CCATATCCTTCTTTGCGTTGGCA No data
Right 943809266 2:192163897-192163919 ATAACAATATAGAAAGGAATGGG No data
943809261_943809263 16 Left 943809261 2:192163852-192163874 CCATATCCTTCTTTGCGTTGGCA No data
Right 943809263 2:192163891-192163913 ACACCAATAACAATATAGAAAGG No data
943809261_943809265 21 Left 943809261 2:192163852-192163874 CCATATCCTTCTTTGCGTTGGCA No data
Right 943809265 2:192163896-192163918 AATAACAATATAGAAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943809261 Original CRISPR TGCCAACGCAAAGAAGGATA TGG (reversed) Intronic