ID: 943809262

View in Genome Browser
Species Human (GRCh38)
Location 2:192163858-192163880
Sequence GTTACATGCCAACGCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943809262_943809265 15 Left 943809262 2:192163858-192163880 CCTTCTTTGCGTTGGCATGTAAC No data
Right 943809265 2:192163896-192163918 AATAACAATATAGAAAGGAATGG No data
943809262_943809267 27 Left 943809262 2:192163858-192163880 CCTTCTTTGCGTTGGCATGTAAC No data
Right 943809267 2:192163908-192163930 GAAAGGAATGGGAAATAATGAGG No data
943809262_943809266 16 Left 943809262 2:192163858-192163880 CCTTCTTTGCGTTGGCATGTAAC No data
Right 943809266 2:192163897-192163919 ATAACAATATAGAAAGGAATGGG No data
943809262_943809263 10 Left 943809262 2:192163858-192163880 CCTTCTTTGCGTTGGCATGTAAC No data
Right 943809263 2:192163891-192163913 ACACCAATAACAATATAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943809262 Original CRISPR GTTACATGCCAACGCAAAGA AGG (reversed) Intronic