ID: 943809265

View in Genome Browser
Species Human (GRCh38)
Location 2:192163896-192163918
Sequence AATAACAATATAGAAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943809258_943809265 28 Left 943809258 2:192163845-192163867 CCCTTTTCCATATCCTTCTTTGC No data
Right 943809265 2:192163896-192163918 AATAACAATATAGAAAGGAATGG No data
943809261_943809265 21 Left 943809261 2:192163852-192163874 CCATATCCTTCTTTGCGTTGGCA No data
Right 943809265 2:192163896-192163918 AATAACAATATAGAAAGGAATGG No data
943809259_943809265 27 Left 943809259 2:192163846-192163868 CCTTTTCCATATCCTTCTTTGCG No data
Right 943809265 2:192163896-192163918 AATAACAATATAGAAAGGAATGG No data
943809262_943809265 15 Left 943809262 2:192163858-192163880 CCTTCTTTGCGTTGGCATGTAAC No data
Right 943809265 2:192163896-192163918 AATAACAATATAGAAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943809265 Original CRISPR AATAACAATATAGAAAGGAA TGG Intronic