ID: 943810343

View in Genome Browser
Species Human (GRCh38)
Location 2:192179663-192179685
Sequence CAGGATCTGGAGATGGAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 647}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943810343_943810347 -8 Left 943810343 2:192179663-192179685 CCTACCTCCATCTCCAGATCCTG 0: 1
1: 0
2: 5
3: 70
4: 647
Right 943810347 2:192179678-192179700 AGATCCTGATCCTGCATCTGTGG 0: 1
1: 0
2: 1
3: 15
4: 219
943810343_943810349 -6 Left 943810343 2:192179663-192179685 CCTACCTCCATCTCCAGATCCTG 0: 1
1: 0
2: 5
3: 70
4: 647
Right 943810349 2:192179680-192179702 ATCCTGATCCTGCATCTGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 150
943810343_943810352 -4 Left 943810343 2:192179663-192179685 CCTACCTCCATCTCCAGATCCTG 0: 1
1: 0
2: 5
3: 70
4: 647
Right 943810352 2:192179682-192179704 CCTGATCCTGCATCTGTGGGGGG 0: 1
1: 0
2: 1
3: 22
4: 186
943810343_943810348 -7 Left 943810343 2:192179663-192179685 CCTACCTCCATCTCCAGATCCTG 0: 1
1: 0
2: 5
3: 70
4: 647
Right 943810348 2:192179679-192179701 GATCCTGATCCTGCATCTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 163
943810343_943810350 -5 Left 943810343 2:192179663-192179685 CCTACCTCCATCTCCAGATCCTG 0: 1
1: 0
2: 5
3: 70
4: 647
Right 943810350 2:192179681-192179703 TCCTGATCCTGCATCTGTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943810343 Original CRISPR CAGGATCTGGAGATGGAGGT AGG (reversed) Exonic
900001375 1:16706-16728 CAGGAGCTGGGGGTGGTGGTGGG + Intergenic
900021095 1:187228-187250 CAGGAGCTGGGGGTGGTGGTGGG + Intergenic
900346340 1:2212287-2212309 CAGGATCCGGAGCAGGAGGGTGG + Intronic
900516048 1:3082668-3082690 CAGGATCTGGAGCTGGACCTGGG + Intronic
900641023 1:3688086-3688108 GAGGATCTGTAGCTGGAGGAAGG + Intronic
900976799 1:6022574-6022596 AAGGTTCTGGAGATGGATGGTGG - Intronic
901135304 1:6989134-6989156 CAGGCTGTGGTGGTGGAGGTGGG - Intronic
901228028 1:7625698-7625720 CAGGATGTGGCGATGAAGATGGG + Intronic
901276660 1:7996826-7996848 CAGGAGCAAGAGATGGGGGTCGG + Intergenic
901654241 1:10760230-10760252 CAGCCTCTGGAGATGGAGAAAGG + Intronic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
902407306 1:16191788-16191810 CAGGACCTGGAGATGGCGTCTGG - Intergenic
902510739 1:16965775-16965797 CAGGTCCTGGAGATGGTGGCTGG - Exonic
902837373 1:19055456-19055478 CAGGACCAGGAGATGGGGCTGGG + Intergenic
903223865 1:21884265-21884287 CAGGATCTGAAGCTGGAAGCTGG + Intronic
903616745 1:24665074-24665096 TAGGATTTAGAGATGGAGGAAGG + Intronic
904913781 1:33954868-33954890 AAGGTTCTGGAGATGGATGGCGG + Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
906128577 1:43442431-43442453 CAGCAGCTGTAGCTGGAGGTCGG - Exonic
906517302 1:46447395-46447417 CTGGAGCTGGCGCTGGAGGTGGG - Intergenic
906590160 1:47017472-47017494 CAGGGGGTGGAGATGGGGGTGGG + Intergenic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907345993 1:53780725-53780747 AAGGTTCTGGAGATGGATGGTGG + Intronic
907380356 1:54082047-54082069 CAGGTTCTGGAGGTGGAGTCAGG + Intronic
907526408 1:55056520-55056542 CAGGGCCTGGGGATGGAGATGGG - Intronic
907598262 1:55740620-55740642 CAGTATCTGGAGGTGTATGTGGG - Intergenic
907742297 1:57178883-57178905 CAGGAGGTGGCGATGGGGGTGGG - Intronic
908410309 1:63857839-63857861 CAGGATGGGGACTTGGAGGTGGG - Intronic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
909012297 1:70348356-70348378 CAGGACTGGGAGGTGGAGGTTGG - Intronic
909490024 1:76215849-76215871 CAGCTTCAGGAGATGGATGTAGG + Intronic
910834345 1:91493239-91493261 AGGGATCTGGAGATGGATGGTGG + Intergenic
912094364 1:106120749-106120771 CAGGATCTGGAGCTGTGGCTGGG - Intergenic
912215972 1:107612787-107612809 CAGCAGCTGGAAAAGGAGGTAGG - Intronic
912243911 1:107940870-107940892 AAGGTTCTGGAGATGGATGGTGG + Intronic
912412166 1:109487047-109487069 CAGGGGCTGGAGGTGGGGGTGGG - Exonic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
912794181 1:112681110-112681132 CGGAATGTGGAAATGGAGGTTGG - Intronic
912995182 1:114526105-114526127 CAGGCTTTGAAAATGGAGGTAGG - Intergenic
913069553 1:115286473-115286495 CAGGATCTGGACTTCGAGGTCGG - Exonic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913615695 1:120558048-120558070 CAGAACCTGGAGATTGAGCTTGG + Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
914574581 1:148952854-148952876 CAGAACCTGGAGATTGAGCTTGG - Intronic
915109591 1:153554552-153554574 CAGGCTTTGGAGATGGCTGTGGG + Intergenic
915137266 1:153741547-153741569 CAGAATCTGGAGATAGAGAAAGG - Intronic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916157352 1:161866629-161866651 TATGATTTGGAGAGGGAGGTTGG + Intronic
916456654 1:164977853-164977875 CAGGATTTGGCGATGCAGGCAGG - Intergenic
916811921 1:168313106-168313128 CACTAGCTGGAGGTGGAGGTGGG + Exonic
917119769 1:171635184-171635206 GAGCACCAGGAGATGGAGGTGGG + Intergenic
917214702 1:172665828-172665850 CAGGATCTGGTGATGATGGAGGG + Exonic
917412382 1:174772665-174772687 AAAGATCTGGAGATGGATGGTGG - Intronic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
918709983 1:187714997-187715019 CAGGGTCTGGAGAACGAAGTTGG - Intergenic
919469217 1:197958017-197958039 AAGGATCTGGAGTTGGGGGATGG + Intergenic
919484241 1:198127545-198127567 TAGGATCTGGAGAAAGGGGTAGG - Intergenic
919519635 1:198571878-198571900 CATGAGCTGGAGATGGAGCAGGG + Intergenic
919917931 1:202150538-202150560 AGGGCTCTGGAGATGGAGGCAGG + Intronic
919977686 1:202623402-202623424 GAGTCTCTGGAGAAGGAGGTGGG - Intronic
921149518 1:212388371-212388393 CAGGATTTTGTGAGGGAGGTAGG - Intronic
921727006 1:218534943-218534965 CAGGATCTGGTGATGAAGTATGG + Intergenic
921946351 1:220888424-220888446 CAGGATCTGGAGTTTGATGTTGG + Intergenic
922097685 1:222456514-222456536 CAGGATCTGGAGGTGGTGACAGG - Intergenic
922944840 1:229504596-229504618 TAGGATCCAGAAATGGAGGTAGG + Intronic
923147804 1:231210071-231210093 CAGCATGTGGGGATGGACGTGGG + Intronic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
924329118 1:242924799-242924821 CAGGAGGCGGAGGTGGAGGTTGG - Intergenic
924659104 1:246000393-246000415 CAGAATGTGAAGATGGAGATAGG + Intronic
1063102568 10:2963257-2963279 CAGGCCCAGGAGATGGAGGGTGG - Intergenic
1063214486 10:3912116-3912138 GAGGATCTGGAGCAGGAGCTCGG + Intergenic
1063573884 10:7243513-7243535 CAGGGTCTGGAGATTCAGGAGGG - Intronic
1063617596 10:7614856-7614878 CAGGACCTGGAGGTGGACGCAGG + Intronic
1063929119 10:11011389-11011411 AAGGATGGGCAGATGGAGGTGGG + Intronic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1064234969 10:13565365-13565387 CAGGAGCAGGGGATGGGGGTGGG - Intergenic
1064427761 10:15245137-15245159 CAGGATGTGGAGGTTGAGGTGGG - Intronic
1064997478 10:21309522-21309544 CACCACCTGGTGATGGAGGTGGG - Intergenic
1065281788 10:24146569-24146591 CCAGCTCAGGAGATGGAGGTGGG + Intronic
1065309896 10:24404963-24404985 CAGGGACTGGGGATGTAGGTGGG + Intronic
1065645196 10:27826687-27826709 GAGGATGTGGAGAGGGAGGCAGG - Intronic
1066221478 10:33339039-33339061 AAGGATCTGGCGGTGGAGATTGG + Intergenic
1066406945 10:35127246-35127268 CAGGAGGTGGAGGTGGAGGCAGG + Intronic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067028602 10:42865562-42865584 AAGGTTCTGGAGATGGACGGTGG + Intergenic
1067233451 10:44427522-44427544 CAGGACCTGGAGTTTGAGGATGG - Intergenic
1067734669 10:48840260-48840282 CAGAGTCTGGTGATGGAGGTGGG + Intronic
1067752830 10:48983279-48983301 CAGGTTGTGGAGATGGGGGTGGG - Intergenic
1067912550 10:50361209-50361231 CAAGAGCTGGCGATGGGGGTAGG + Intronic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1068980372 10:63056594-63056616 CAAGATGTGGAGAAAGAGGTTGG - Intergenic
1069185727 10:65420268-65420290 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1069627365 10:69876596-69876618 CAGGATCTGGAGTTAGAGAACGG - Intronic
1069925810 10:71850180-71850202 CTGGATCTGGAGAGGAAGGAAGG - Intronic
1070161318 10:73868313-73868335 CATGGTGTGGGGATGGAGGTGGG - Intronic
1070711665 10:78687432-78687454 CAGAGACTGGAGATGGAGGAAGG + Intergenic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1071212346 10:83358479-83358501 CAAGATGTGGAGATGGAGGGGGG - Intergenic
1071309020 10:84326210-84326232 CAGGTTTTGAAGATGGAGGAAGG + Intergenic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1073035752 10:100563106-100563128 GGAGAGCTGGAGATGGAGGTTGG + Intergenic
1073412726 10:103355493-103355515 AAGAATCTGGAGATGGAGGGTGG + Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1075067388 10:119298629-119298651 CAGGATTTGGAGATTAAGGGAGG - Intronic
1075135488 10:119781754-119781776 CAGGATCTTGAGCTAGAGGTAGG + Exonic
1075224347 10:120612894-120612916 CAGGACCTGGAGGTTGGGGTTGG + Intergenic
1075311796 10:121420501-121420523 CAGGCTCTGGGGGTGGAGGAAGG - Intergenic
1075574763 10:123570403-123570425 CAGGCTCTGGGGAAGGAGGAAGG - Intergenic
1075914030 10:126150569-126150591 CAGGATCAGGGGATAGAGGGTGG - Intronic
1076062185 10:127421557-127421579 AAGGCTCTGGAGATGGATGGTGG - Intronic
1076817270 10:132921145-132921167 CAGCCTGTGGAGATGGTGGTCGG - Intronic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077182072 11:1221222-1221244 AACGTTCTGGAGATGGAGGGCGG - Intergenic
1077290301 11:1786636-1786658 CTGGCTTTGAAGATGGAGGTGGG - Intergenic
1077999093 11:7478765-7478787 CAGGATCTAGAACTGGATGTGGG - Intergenic
1078367067 11:10715597-10715619 CAGGGTGTGGAGATGGAGACTGG - Intergenic
1078376034 11:10793985-10794007 CAGGATGTGGACATAGAGGAAGG - Intergenic
1078406686 11:11075977-11075999 CAGGCTCTGGAGCTGGAACTTGG + Intergenic
1078866434 11:15302357-15302379 CAGGATCCAGAGATGGGGATGGG - Intergenic
1079688027 11:23386045-23386067 CAGGAATGGGAGATGGAAGTGGG - Intergenic
1079742951 11:24086521-24086543 CAGTATCTGGAGGGGGAGGAGGG - Intergenic
1080510910 11:32970476-32970498 CAGGAGGTGGAGATGGCAGTGGG - Intronic
1080881068 11:36321334-36321356 CAGGATCTGGAGGAGGAAGCAGG - Intronic
1081605799 11:44526491-44526513 CAGGGCCTGGAGAAGGGGGTGGG - Intergenic
1082009552 11:47441166-47441188 CAGGATCTGGCCGAGGAGGTGGG - Exonic
1082817888 11:57522450-57522472 CTGGATGTGGAGAGTGAGGTGGG - Intergenic
1083035189 11:59630363-59630385 CAGGAGGCTGAGATGGAGGTTGG + Intergenic
1084031665 11:66484825-66484847 CAGGCTCTGGAGAAAGAGGGAGG + Intronic
1084085199 11:66851846-66851868 CAGCATCTGGAAAGGGATGTTGG + Exonic
1084493513 11:69490835-69490857 CAGAGTCTGGAAAGGGAGGTGGG - Intergenic
1084676094 11:70635613-70635635 AAGGTTCTGGAGATGGATGGTGG + Intronic
1084704511 11:70808065-70808087 AAGGTTCTGGAGATGGATGGTGG + Intronic
1084763007 11:71285911-71285933 CAAGTTCTGGAGATGGATGATGG - Intergenic
1084876490 11:72137386-72137408 CAGGGTCTGGAGGTCCAGGTGGG - Intronic
1085018313 11:73189651-73189673 CAGGAGCTGGAGATGAGGGGAGG - Intergenic
1086331256 11:85756396-85756418 CAGGACCTGGCAATGGAGGAAGG - Intronic
1087158453 11:94926739-94926761 CTGGATCTTGAGTTGGGGGTGGG - Intergenic
1087990715 11:104743407-104743429 GATGAACTGGAGATGGAGGAAGG + Intergenic
1088207076 11:107404544-107404566 CAGGAGCTGGGGTGGGAGGTGGG + Intronic
1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG + Intergenic
1088757290 11:112896314-112896336 CAGGAGCAGGAGTGGGAGGTGGG - Intergenic
1089015450 11:115161636-115161658 CAGCACATGGTGATGGAGGTGGG + Intergenic
1089159814 11:116428741-116428763 CAGTTTCTGAAGATGGAGCTCGG + Intergenic
1090057406 11:123435149-123435171 CAGGATTTGGAAATGATGGTTGG + Intronic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1091131653 11:133151765-133151787 GAAGAGCAGGAGATGGAGGTGGG + Intronic
1091374464 12:16821-16843 CAGGAGCTGGGGGTGGTGGTGGG + Intergenic
1091602049 12:1923718-1923740 AGGGTTCTGGAGATGGAGGGTGG + Intergenic
1091686890 12:2568794-2568816 TGGGTTCTGGAGATGGAGGATGG + Intronic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1092204864 12:6608525-6608547 CAGCGCCTGGAGATGGGGGTGGG - Intergenic
1092288089 12:7141435-7141457 CAGGATTTGGGAAGGGAGGTAGG + Intronic
1092489136 12:8929381-8929403 CAGGCTGTGGATAAGGAGGTAGG - Intronic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1092784752 12:12017102-12017124 GAGGAGTTGGAGATGGCGGTTGG + Intergenic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1094252220 12:28376069-28376091 CTGAATCTGTAGATGTAGGTAGG + Intronic
1094754643 12:33453872-33453894 CAGGATCTGGGGAAGGGGGCAGG + Intergenic
1095476399 12:42590501-42590523 CAGGCTCTGGACATTGCGGTGGG - Intergenic
1095651127 12:44610555-44610577 CAGGATGTGGTGATGGGTGTGGG + Intronic
1095791369 12:46170866-46170888 CAGGATTTGGAGTTGGACATAGG - Intergenic
1096056906 12:48660847-48660869 CAGGATCCTGAAAAGGAGGTTGG - Intronic
1096418082 12:51431114-51431136 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1096666538 12:53170088-53170110 GAGGATCTGGAGAGGCAGATTGG - Exonic
1096673425 12:53213695-53213717 CAGCATCTGGAGGTGGGGGGTGG + Exonic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1097053824 12:56238648-56238670 CTGGAGCTGGAGAAGGGGGTAGG + Exonic
1097174875 12:57136683-57136705 GAGGATGTGGTGATAGAGGTTGG + Intronic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098157006 12:67609505-67609527 CAGGCCATGGAGCTGGAGGTAGG - Intergenic
1099581691 12:84455863-84455885 GAGGAGCTGGAGATGGAAGAAGG - Intergenic
1100512511 12:95290617-95290639 AAGGAATTGGAGATGGAGGGAGG + Intronic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1100792254 12:98143404-98143426 CAGGAACTAGAGAGGGAGGAGGG + Intergenic
1102514589 12:113437859-113437881 CAGGATCGGGGGATGGAGAGAGG - Intronic
1103702501 12:122855192-122855214 CAGGCTATGGAGATGGCGGAAGG + Intronic
1104899414 12:132180476-132180498 CAGGTTCTGGGGGTGGGGGTGGG + Intergenic
1104957016 12:132471942-132471964 AAGGCTCTGGGCATGGAGGTCGG - Intergenic
1105281367 13:18964618-18964640 CTGGAGCTGGAGCTGGAGCTGGG - Intergenic
1105287284 13:19014691-19014713 CAGGAGTTGGAGATGGAGTTGGG - Intergenic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1106880325 13:34122191-34122213 CAGGATGTCAAGGTGGAGGTAGG - Intergenic
1107418738 13:40225501-40225523 TAGTAGCTGGAGGTGGAGGTGGG + Intergenic
1107853755 13:44594881-44594903 CAGGAGCTGGGGTGGGAGGTGGG - Intergenic
1107968982 13:45623045-45623067 CAGGATCTTGGGAGGGGGGTGGG + Intergenic
1110399779 13:75076526-75076548 CAGGAGCTGGAGAGTGGGGTGGG - Intergenic
1110810557 13:79807496-79807518 CAGCCTGTGGAGATGGGGGTAGG - Intergenic
1111161120 13:84396088-84396110 CAGAATCTGAAAAAGGAGGTAGG + Intergenic
1112346408 13:98593679-98593701 AAAGTTCTGGAGATGGAGGGTGG - Intergenic
1112370844 13:98792076-98792098 GAGTATCTGGAGATGGAGGGTGG + Intergenic
1112627658 13:101123941-101123963 CAAGATTGGGAGCTGGAGGTAGG - Intronic
1113043436 13:106128526-106128548 CTGGCTTTGGAGATGGAGGAAGG - Intergenic
1113651949 13:112039733-112039755 CAGGCTCTGGAGATGGAGCCGGG - Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1113833242 13:113313391-113313413 CAGGATCTGGACACAGAGGAAGG - Intronic
1114311107 14:21468114-21468136 AAAGTTCTGGAGATGGATGTTGG + Intronic
1115106417 14:29767087-29767109 CAGGATTTGGAGGTGAGGGTTGG - Intronic
1115194642 14:30783145-30783167 GAGTGTCTGGAGCTGGAGGTTGG + Intergenic
1115618480 14:35119007-35119029 CAGAAGCTGGAGAGGGATGTGGG + Intronic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1117071552 14:52061569-52061591 CAGGATCTCAGGGTGGAGGTTGG + Intronic
1117274047 14:54174408-54174430 AAGGAACTGGGGATGGAAGTGGG - Intergenic
1117457137 14:55909703-55909725 CTGGGGCTGGAGGTGGAGGTGGG + Intergenic
1117623877 14:57616151-57616173 AAAGTTCTGGAGATGGATGTTGG - Intronic
1118302218 14:64625943-64625965 CTGGATCTGGAGCAGGAGGGAGG + Intergenic
1118635187 14:67742302-67742324 AAAGTTCTGGAGATGGATGTTGG + Intronic
1118864595 14:69693105-69693127 CACCATCTGGAGGTGGAGGTAGG + Intronic
1119076477 14:71645117-71645139 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1120049354 14:79847238-79847260 GAGGGTGTGGAGATGGAGATTGG - Intronic
1120143783 14:80957201-80957223 CAGGATCTGGATCTGGGAGTAGG - Intronic
1120145969 14:80978663-80978685 CAGGTGCTGCAGATGGAGGCTGG + Intronic
1121268793 14:92623862-92623884 TGGCATCTGGAGATGGAGGCTGG + Intronic
1121290781 14:92773265-92773287 CTGGATCTGACGATGGAGGGAGG - Intergenic
1122183708 14:99972755-99972777 CAGGATCTGGAGAGGAAGGGAGG - Intronic
1122207642 14:100156046-100156068 CAGGAGCTGGAGATGGACTTTGG + Intronic
1122223915 14:100261565-100261587 CTGCATATGGACATGGAGGTTGG - Intronic
1122549052 14:102540096-102540118 CAGGCTCTGGAGGAGGAGGCCGG - Intergenic
1122769652 14:104092312-104092334 AAGCATTTGGAGAAGGAGGTGGG + Intronic
1124410552 15:29432959-29432981 AAAGACCTGCAGATGGAGGTGGG - Intronic
1124493334 15:30171766-30171788 GAGTCTCTGGAGAAGGAGGTGGG - Intergenic
1124750200 15:32366559-32366581 GAGTCTCTGGAGAAGGAGGTGGG + Intergenic
1125790482 15:42361765-42361787 CAGGATCTGGGGAAAGAGGATGG - Intronic
1126427528 15:48545602-48545624 AAGGTTCTGGAGATGGATGGGGG + Intronic
1126810141 15:52394149-52394171 CCTGATCTGGGGATGTAGGTGGG - Intronic
1127074332 15:55311017-55311039 CAGAATCAGGATATGGAGATTGG - Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1128130911 15:65226499-65226521 CAGGATCTGGGGAGAGTGGTTGG - Intergenic
1128604854 15:69029079-69029101 AAGGTTCTGGAGATGGAGGGTGG - Intronic
1128736687 15:70057619-70057641 TAGGAGCTGGTGATGGAGATGGG + Exonic
1129044505 15:72721890-72721912 CAGTATCAAGAGATGCAGGTTGG + Intronic
1129093762 15:73181608-73181630 CAGGATCAGGAGAGTGAGGTGGG + Intronic
1129157862 15:73730001-73730023 CTGAATCTGGAGAGGGAGTTAGG + Intergenic
1129159873 15:73741248-73741270 CGGGAGATGGAGATGGGGGTGGG - Intronic
1129171756 15:73812277-73812299 CAGGATCAGGGGATGGGGGCTGG - Intergenic
1129233394 15:74209133-74209155 CCTGAGCTGGAGATGGGGGTGGG - Intronic
1129450187 15:75647358-75647380 CAGGATCGGGAGATCGGGGTGGG - Intronic
1129514173 15:76146848-76146870 CTGGGTGTGGTGATGGAGGTAGG - Intronic
1129537756 15:76328002-76328024 AAGGATATGGAGTTGGAGTTGGG - Intergenic
1130533367 15:84765006-84765028 CAGGTTCTGGAGATGGACAGTGG - Intronic
1130957408 15:88637467-88637489 CAGGGCATGAAGATGGAGGTGGG + Intronic
1131021727 15:89104743-89104765 GAGGAAATGGAGATGGGGGTGGG - Intronic
1131358985 15:91772601-91772623 CAGGCTCTGGGGGTGGGGGTGGG + Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1132366649 15:101262541-101262563 CCTGAGCTGGAGGTGGAGGTGGG - Intergenic
1132452132 15:101974232-101974254 CAGGAGCTGGGGGTGGTGGTGGG - Intergenic
1132454761 16:16389-16411 CAGGAGCTGGGGGTGGTGGTGGG + Exonic
1132462149 16:60940-60962 GAGGAGCTGGAGATGGGGGAGGG + Intronic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133012528 16:2922406-2922428 AAGGTTCTGGAGATGGACGGTGG - Intronic
1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG + Intergenic
1133398796 16:5469665-5469687 CAGGGGCTGGGGATGGAGGAAGG - Intergenic
1133403008 16:5502427-5502449 CAGGGGGTGGACATGGAGGTTGG + Intergenic
1133451074 16:5904496-5904518 CAGAATGTGGGGATGGTGGTGGG + Intergenic
1133474650 16:6108690-6108712 CAGGACCTTGAGAAGGAGATAGG - Intronic
1133736036 16:8616508-8616530 CAGGGGCTGGACCTGGAGGTGGG - Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134579175 16:15357234-15357256 CAGGATCTGGAGGCTGAGGCAGG + Intergenic
1134723410 16:16400319-16400341 CAGGATCTGGAGGCTGAGGCAGG - Intergenic
1134944018 16:18311551-18311573 CAGGATCTGGAGGCTGAGGCAGG + Intergenic
1135031634 16:19043494-19043516 AAGGTTCTGGAGATGGATGCTGG - Intronic
1135379653 16:21984505-21984527 CAGTCTCTGGAGATGGATATTGG + Exonic
1135688708 16:24519217-24519239 CAGTGTCTGGAGATCGAGGCAGG - Intergenic
1136025318 16:27464802-27464824 CAGCATCAGGTGCTGGAGGTCGG - Exonic
1136093482 16:27937320-27937342 TTGAACCTGGAGATGGAGGTTGG - Intronic
1136093670 16:27938301-27938323 TTGAACCTGGAGATGGAGGTTGG + Intronic
1136185683 16:28587555-28587577 CAGGGCCAGAAGATGGAGGTAGG - Intronic
1136287721 16:29254122-29254144 GAGGAAATGGAGCTGGAGGTGGG - Intergenic
1137518925 16:49175107-49175129 TGGGATGGGGAGATGGAGGTAGG - Intergenic
1137518943 16:49175208-49175230 TGGGATGGGGAGATGGAGGTAGG - Intergenic
1138057328 16:53848782-53848804 CAGGAGCTGGGTGTGGAGGTGGG + Intronic
1139463737 16:67142716-67142738 CAGGGTCTGGAGCTGCAGCTGGG + Intronic
1139914430 16:70419314-70419336 CAGGATCTGGGGATAGATGGTGG - Intronic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140661035 16:77191474-77191496 AGGGATGTGCAGATGGAGGTCGG + Exonic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141635242 16:85310897-85310919 CAGGGGCTGGGGATGGAGGGGGG + Intergenic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1142093345 16:88226750-88226772 GAGGAAATGGAGCTGGAGGTGGG - Intergenic
1142160083 16:88552829-88552851 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142198044 16:88747869-88747891 CCGGCTCTGGAGATGGAGGGAGG + Intronic
1142698577 17:1646507-1646529 CAGGAGCTGGAGACTGTGGTTGG + Exonic
1143021762 17:3920425-3920447 CAGGATTGGGAGCTGGCGGTGGG - Intergenic
1143223631 17:5282286-5282308 CAGGATGAGGAGGCGGAGGTCGG + Exonic
1143462673 17:7114254-7114276 CTGGAGCTGGAGCTGGAGCTGGG + Exonic
1143476763 17:7207600-7207622 CAGAAAATGGAAATGGAGGTTGG + Intronic
1143480675 17:7225996-7226018 GAGGGACTGGAGGTGGAGGTGGG + Exonic
1143874316 17:9980346-9980368 CTGGATCGGAAGAGGGAGGTGGG - Intronic
1143969786 17:10787308-10787330 CAAGACCTGGGGATGGAGCTGGG - Intergenic
1144677098 17:17168590-17168612 CAGGCCCTGGAGGTGGTGGTGGG + Intronic
1144773445 17:17771960-17771982 CATTAACTGGAGATGGAGGGTGG + Intronic
1144887009 17:18470225-18470247 AAGGTTCTGGAGATGGATGGTGG - Intergenic
1145145207 17:20474070-20474092 AAGGTTCTGGAGATGGATGGTGG + Intergenic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145214440 17:21041975-21041997 GAGGAGCTGGAGGTGGAGGGCGG - Intronic
1145904027 17:28506624-28506646 AAGGAACTGGAGGGGGAGGTGGG - Intronic
1145904636 17:28509411-28509433 CAGGAGGTGGAGATGGGGATAGG - Intronic
1145992434 17:29087116-29087138 CAGGCTCTGGATAGGTAGGTGGG + Exonic
1146353730 17:32117300-32117322 AAGGTTCTGGAGATGGATGGTGG - Intergenic
1146509034 17:33429987-33430009 TAGGATCTGGATATGGTGTTTGG - Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1147469423 17:40645581-40645603 CAGGAGCTGGGGTGGGAGGTGGG + Exonic
1147677552 17:42218589-42218611 CAGCAACTGGAGATGGAGTTGGG + Intronic
1147688486 17:42300982-42301004 CAGCAACTGGAGATGGAGTTGGG - Intronic
1148104473 17:45112126-45112148 CAGGTTCCGGAGCTGGAGGGAGG + Exonic
1148625570 17:49066598-49066620 GAAGATCTGGAGAGGGAGGTTGG + Intergenic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1150097517 17:62390400-62390422 CAGGAAGTAGACATGGAGGTGGG + Intronic
1151039324 17:70840253-70840275 CAGCATCTGGAGCTGGAAGCAGG + Intergenic
1151378712 17:73710098-73710120 CAAGGTCTGCAGATGGAGCTTGG - Intergenic
1151573834 17:74941376-74941398 CAGGGGCTGGAGATGGAGAAAGG - Intronic
1151788717 17:76290130-76290152 CAGGGGCTGGAAATGGAGATTGG - Intronic
1151979940 17:77502795-77502817 CAGGACTTGGAGAGGGTGGTCGG - Intergenic
1152863005 17:82706625-82706647 GAAGACCTGGAGATGGAGGGTGG - Intergenic
1153214400 18:2805882-2805904 AGGGATCTGGAGCTAGAGGTGGG - Intergenic
1153341115 18:3975978-3976000 CAGGTTCTGGAGATGGATGGTGG + Intronic
1155991918 18:32287045-32287067 GAGGCACTGGAGGTGGAGGTAGG + Exonic
1156301354 18:35839091-35839113 TGGCATCTGGAGATGGAGGCTGG - Intergenic
1156318129 18:35990445-35990467 CTGCATCTGGACAGGGAGGTTGG + Exonic
1156591402 18:38493263-38493285 AGGGTTCTGGAGATGGATGTTGG + Intergenic
1157519206 18:48333969-48333991 TAGGATCAGGAGGTGCAGGTGGG - Intronic
1157948051 18:52003385-52003407 AAGGTTCTGGAGATGGATGGTGG - Intergenic
1158801556 18:60916787-60916809 CAGGATCTGGGGGTGAGGGTGGG + Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159923379 18:74246702-74246724 GAGGATGGGGAGATGGGGGTGGG - Intergenic
1160033939 18:75284500-75284522 AAAGTTCTGGAGATGGAGGGTGG - Intronic
1160486357 18:79296775-79296797 CAGGTTCTGGGGATAGAGTTGGG + Intronic
1160613586 18:80108104-80108126 GAGGCTCTGGAGAGGGCGGTGGG + Intergenic
1160723726 19:608564-608586 CAGAGCCTGGAGATGGACGTGGG + Intronic
1160737930 19:673067-673089 CGGGATTTGGAGATGGAGGAAGG - Intergenic
1160946260 19:1645348-1645370 CAGGATTTGGTGGGGGAGGTTGG - Intronic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161230429 19:3172325-3172347 GGGGATCTGGAGAGGGATGTGGG - Intronic
1161507051 19:4649788-4649810 CAGGGTCTGGTGACCGAGGTCGG + Intronic
1161592506 19:5135213-5135235 CTGGCTCTGGAGGGGGAGGTCGG - Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162015200 19:7841759-7841781 CAGCATAGGGAGATGGAGATGGG + Intronic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1162174807 19:8823068-8823090 CAGGAGCTGGGACTGGAGGTGGG - Intronic
1162504971 19:11078242-11078264 TCTGATCTGGAGATGGGGGTGGG - Intergenic
1162640209 19:12002608-12002630 CAGGGTCAGGAGATCGAGATTGG - Intergenic
1162740577 19:12771392-12771414 CTGGATCTGGAGCGGCAGGTAGG - Exonic
1162795494 19:13085346-13085368 CAGGCTCTGAAGCTGGAGGAAGG + Intronic
1163026451 19:14515648-14515670 CAGGGACTGGAGGTGGATGTGGG + Exonic
1163617268 19:18336759-18336781 CAAGTTCTGGAGATGGATGGTGG + Intergenic
1163666834 19:18607273-18607295 GAGGGGCTGGAGATGGGGGTAGG - Intronic
1163823107 19:19507573-19507595 CAGGAGCTGGAGCTGGGGCTGGG - Exonic
1164323180 19:24168796-24168818 CAGGATCAGAACATGGAGATTGG - Intergenic
1164638406 19:29807839-29807861 CAGGCTCTGATGATGGAGGACGG - Intergenic
1164790248 19:30971453-30971475 GAGAGTCTGGAGAAGGAGGTGGG - Intergenic
1165423742 19:35734455-35734477 AAGGATCGGGAGCGGGAGGTGGG + Intronic
1165567253 19:36741513-36741535 AGGGTTCTGGAGATGGACGTTGG + Intronic
1166101793 19:40575876-40575898 CAGGATCTGCAGATCGGGGCTGG - Exonic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166355744 19:42226239-42226261 GAGGCTCTGGAGGTGGGGGTGGG - Exonic
1166510617 19:43406481-43406503 CGGGAACTGAAGATGGAGGCGGG - Exonic
1166782807 19:45351209-45351231 CTGGACCTGGAGCTGGAGGGTGG + Exonic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1166981772 19:46635549-46635571 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981798 19:46635619-46635641 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981814 19:46635657-46635679 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1166981830 19:46635695-46635717 GAGGATGGGGAGATGGAGGGAGG + Intergenic
1167130666 19:47583356-47583378 CAGGATGTGGCGAGGGATGTTGG - Intergenic
1167387425 19:49171957-49171979 CAGGAGTTGGGGATGGAGGCGGG + Intronic
1167404325 19:49294449-49294471 CAGGCATTGTAGATGGAGGTTGG + Exonic
1167583441 19:50359700-50359722 CTGGCTCTGGAGCTGGAGGCTGG - Intronic
1167873958 19:52396320-52396342 CTGGATCTGGAGGTAGAGGCTGG + Intergenic
1168259517 19:55185683-55185705 CAGGCTCTGGAGATGAATGTAGG + Intronic
925373352 2:3363144-3363166 CAGGATCTGTATGTGGAGCTGGG - Intronic
925743152 2:7022682-7022704 CCGGATCTGGTGATCAAGGTTGG - Intronic
926349449 2:11982054-11982076 CAGGATAGGGTGATGGAGCTAGG + Intergenic
927003084 2:18819493-18819515 GAGGATCTGGTGAAGAAGGTTGG + Intergenic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928089008 2:28362911-28362933 CAGGGTCTGGAGATGGGGAGTGG - Intergenic
928170082 2:28997981-28998003 CAGGCTCTGGTGTTGGGGGTGGG + Intronic
928531666 2:32198918-32198940 AAGGTTCTGGAGATGGATGGTGG - Intronic
928607860 2:32960676-32960698 CAGGAGCTGGAACTGGAGGTGGG + Intronic
928979305 2:37121810-37121832 CACGACATGGAGATGGAGGTGGG + Intronic
929378495 2:41320347-41320369 CAAAATCTGCAGATGGAGCTGGG + Intergenic
929454300 2:42055190-42055212 CAGGCTCTGGAGGCAGAGGTGGG + Intronic
930260083 2:49135530-49135552 CAGGATCTTATGATGAAGGTTGG - Intronic
931474237 2:62571341-62571363 CTGGAGATGGAGTTGGAGGTGGG - Intergenic
932016032 2:68027108-68027130 CAGGATCTAGAGATGGGGCAAGG - Intergenic
932333627 2:70916533-70916555 CAGGATTTGGGGATGGAGGAAGG - Intronic
932475948 2:72006004-72006026 CAGGATCTGAAGTTCAAGGTGGG - Intergenic
932860210 2:75283783-75283805 AAAGATCTGGAGATGGATGGTGG - Intergenic
933033264 2:77359480-77359502 AATGATCAGGAGATGGAGGAGGG - Intronic
933305552 2:80593589-80593611 CATGTTCTGGAGATGGAGGGTGG - Intronic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
934646217 2:96060637-96060659 CAGGAGCTGGAGGTGGCTGTGGG - Intergenic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
935396486 2:102615096-102615118 CAGTATCTGGAGCAGGATGTAGG + Intergenic
935727697 2:106038022-106038044 CAGGATCTTGAGATGGGGAGAGG + Intergenic
936568349 2:113596708-113596730 CAGGAGCTGGGGGTGGTGGTGGG - Intergenic
937124484 2:119464784-119464806 TGGGAGCTGGAGATGGTGGTAGG - Intronic
937131654 2:119518446-119518468 CAGGATCTGGAGATGACTCTGGG + Intronic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937363338 2:121244093-121244115 CAGGAGCTGGAGGTGGAGCAGGG - Intronic
937904204 2:127044940-127044962 TAGGATCTGGAGCTGGAGGTGGG - Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
938059092 2:128238370-128238392 AAGGAACTGGATTTGGAGGTGGG + Intronic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
940847038 2:158652721-158652743 CAGGAGCTGGGGCAGGAGGTGGG + Intronic
941062582 2:160864770-160864792 CAGCAGCTGGAGATGGATGTGGG + Intergenic
941863600 2:170310583-170310605 TTGAACCTGGAGATGGAGGTTGG + Intronic
942658555 2:178240190-178240212 AAGGTTCTGGAGATGGATGATGG + Intronic
942775119 2:179572050-179572072 CAGGAAATGTAGTTGGAGGTTGG + Intronic
943441517 2:187932925-187932947 AAGAATCTGGATATGGAGGATGG + Intergenic
943566698 2:189524749-189524771 CAGAATCTGGAGGTGGGGCTAGG - Intergenic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
944857608 2:203783569-203783591 CAAGTGCTTGAGATGGAGGTGGG + Intergenic
947181408 2:227414695-227414717 CTGTATCTGGAGATAGAGATAGG + Intergenic
947458044 2:230274437-230274459 CTGGATGTGGAGATGGATGCAGG + Intronic
947533402 2:230926550-230926572 CAGGCTCTGGGTATGGAGGTGGG - Intronic
947545214 2:231005670-231005692 CAGGGCCTGGTGATAGAGGTAGG - Intronic
947727196 2:232408114-232408136 CAGGGTCTGGAGGTGGGGTTGGG + Intronic
947736348 2:232457413-232457435 CAGGTTCTGGAGGTGGAGTTGGG + Intronic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
948911889 2:241009035-241009057 CAGGACATGGGGATGGAGCTTGG + Intronic
948948857 2:241236064-241236086 CAGGTTCTGGAGGTGAAGGGCGG - Intronic
1168752389 20:291995-292017 CAGGATCTGCTGATGGATGTGGG - Intergenic
1168766925 20:388163-388185 CACGATCTGGAGCAGTAGGTGGG - Exonic
1168848625 20:961639-961661 CAGCATCTGGAGATGGGGTGTGG + Intronic
1168914350 20:1474166-1474188 AAGAATCTTGAGATGGGGGTGGG - Intronic
1170802269 20:19600193-19600215 CAGGGTCTGGAGCTGGAGCTGGG - Intronic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171017188 20:21552764-21552786 AAGGTTCTGGAGATGGACGGTGG - Intergenic
1171276243 20:23858519-23858541 TAGGACCTGGAGATGGAGCACGG + Intergenic
1172268735 20:33640153-33640175 CTGGGTACGGAGATGGAGGTGGG - Intronic
1172648575 20:36487104-36487126 GAGGCTCTGCAGATGGAGGAGGG + Intronic
1173059301 20:39646375-39646397 ATGGATCTGGGGTTGGAGGTAGG - Intergenic
1173153393 20:40587078-40587100 GTGGATCAGGAGCTGGAGGTCGG - Intergenic
1174028440 20:47599858-47599880 CAGGAAGTGGAGATGGATCTGGG - Intronic
1174302987 20:49595614-49595636 CTGGCTTTGAAGATGGAGGTTGG - Intergenic
1174671190 20:52309060-52309082 CAGGCTTTGGAGTGGGAGGTGGG + Intergenic
1175269445 20:57723534-57723556 CAGGAGCTGCAGAGGCAGGTGGG + Intergenic
1175294484 20:57899014-57899036 CTGGATTTGGAGATAGAGGAGGG - Intergenic
1175529429 20:59664303-59664325 AAGGATATGGCCATGGAGGTGGG - Intronic
1175687272 20:61040767-61040789 AAGGGTCAGGAGATGCAGGTCGG + Intergenic
1175876546 20:62232899-62232921 CTGGAGCTGGGGATGGGGGTTGG - Intronic
1175901864 20:62363137-62363159 CAAGATCTGGAGGTGGGGGGGGG - Intronic
1176031386 20:63014700-63014722 CAGAATCTGGGGGTGGGGGTGGG - Intergenic
1176065869 20:63194388-63194410 CAGCATTTGGAGCTGCAGGTGGG + Intergenic
1176726802 21:10442657-10442679 CAGGAGCTGGAGTGGGAGGTAGG - Intergenic
1177009102 21:15709841-15709863 CAGGATCCTGAGAATGAGGTTGG - Intergenic
1178110056 21:29360906-29360928 CAGGATATGGGGATGGGGATTGG - Intronic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1180059034 21:45375306-45375328 CAGGATGTGGGGAGGGAGGGAGG + Intergenic
1180154422 21:45971171-45971193 GTGGCTCTGGAGATGGCGGTGGG - Intergenic
1180756504 22:18165603-18165625 AAGAATCTGTAAATGGAGGTAGG + Intronic
1181075265 22:20371831-20371853 AAGAATCTGTAAATGGAGGTAGG - Intronic
1181438634 22:22924456-22924478 CAGGCTCTGAAGTTGGAGGAAGG - Intergenic
1181941841 22:26483807-26483829 CAGGAGCTGGAGGGGGAGGTAGG - Exonic
1182528760 22:30939079-30939101 GAGGATCCAGACATGGAGGTGGG + Intronic
1182776947 22:32838309-32838331 CAGGACCTGGAGATGGGGCCTGG + Intronic
1182871982 22:33655692-33655714 CAGGACCTGGGGATGGAGACTGG - Intronic
1183429710 22:37758121-37758143 GAGGCACTGGAGAAGGAGGTAGG + Exonic
1183475902 22:38035632-38035654 CAGCACCTGGAGAGTGAGGTGGG - Intronic
1183741137 22:39669256-39669278 AAGGCTCTGGAGCTGGACGTGGG + Intronic
1183792855 22:40087808-40087830 GAGGAGCTGGAGATGTAGGCAGG + Intronic
1183900456 22:41002112-41002134 AAGTATCGGGAGATTGAGGTGGG - Intergenic
1184205348 22:42998956-42998978 CAGGATGGGGAGCTGGAGATGGG - Intronic
1184916482 22:47572465-47572487 CAGGTTCTGGAGAAGGTGATGGG + Intergenic
1185101202 22:48841805-48841827 GAGGATCTGCAGATGGAGCTGGG + Intronic
1185103236 22:48852867-48852889 GAGGATCTGCAGATGGAGCTGGG - Intergenic
1185181256 22:49364649-49364671 CTGGCTTTGGAGATGGAGGAGGG + Intergenic
1185224305 22:49644174-49644196 GTGGGTCTGGAGATGGGGGTGGG + Intronic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
1185393078 22:50573128-50573150 CTGGACCTGGAGATGGGGGTGGG + Intronic
949941973 3:9162196-9162218 AAAGTTCTGGAGATGGATGTAGG + Intronic
950481601 3:13247727-13247749 CTGGATCTGGATCTGGAGGGAGG + Intergenic
950742764 3:15063399-15063421 CAGGCACTTGGGATGGAGGTAGG + Intronic
951598438 3:24343691-24343713 AAGGATTTGGAGATTGTGGTTGG - Intronic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
952421534 3:33136056-33136078 CAGGGGCTGGAGGTGGAGGCAGG - Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953505110 3:43478196-43478218 GAGGTTCTGGAGATGGAAGTTGG + Intronic
953625340 3:44566285-44566307 CAGGACCTTGAGATTGAGGCAGG + Intronic
954066240 3:48108737-48108759 CAGGAGGTGGAGATTGACGTGGG + Intergenic
954326776 3:49868346-49868368 CAGGATCTGCTGTTGGGGGTTGG - Intronic
954425247 3:50439717-50439739 CAGGGTCTGCAGTTGGAGGCCGG + Intronic
955040261 3:55309877-55309899 CAGGTTCTGGAGATGCAGAGGGG + Intergenic
955103987 3:55878400-55878422 CAGGATGGGGAGATGGTGGGAGG - Intronic
955136239 3:56221574-56221596 CAGGATGTTTACATGGAGGTAGG - Intronic
955235319 3:57134239-57134261 CTGGATCTGCTGATGGAAGTTGG - Intronic
955498829 3:59563993-59564015 CTGATTCTGGAGATGGAGTTTGG + Intergenic
957038067 3:75313169-75313191 CATGAAATGTAGATGGAGGTGGG - Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
961353998 3:126322533-126322555 AAGGGTCTGGAGATGGGGGGAGG - Intergenic
961578143 3:127855423-127855445 CTGGCTCTGAAGATGGAGGGAGG - Intergenic
962874585 3:139526197-139526219 AAGGTTCTGGATAAGGAGGTGGG + Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963990275 3:151645051-151645073 CAGTCTCTGGGGATGGAGGGAGG - Intergenic
964854471 3:161131511-161131533 CAGGAGGTGGAGATTGAGGTGGG - Intronic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
966223186 3:177570596-177570618 CAGGACCTGGAAATGGATGCCGG + Intergenic
966921622 3:184615528-184615550 AAGGGGCTGGATATGGAGGTAGG - Intronic
967265562 3:187688178-187688200 CAGGATCTGGAGATGAAGACAGG + Intergenic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
969241795 4:5903699-5903721 AAGGTTCTGGAGATGGATGATGG + Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969429833 4:7147669-7147691 GAGGCTCTGGAGATCCAGGTAGG - Intergenic
969895052 4:10295859-10295881 GAGGAAATGGTGATGGAGGTAGG + Intergenic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971181122 4:24329398-24329420 CCGGAGCTGGAGAGGCAGGTAGG - Intergenic
972072935 4:35044736-35044758 CAGGAGGTGGTGAGGGAGGTTGG + Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
972569066 4:40294447-40294469 GTGGAGATGGAGATGGAGGTGGG - Intergenic
973712962 4:53647702-53647724 CAAGATCTAGAGATGGATGGTGG - Intronic
974064599 4:57065951-57065973 CTGGGGCTGGAGATGGGGGTAGG - Intronic
974517270 4:62934105-62934127 CTGGAGCTGGAGAAGTAGGTAGG - Intergenic
976252232 4:83064439-83064461 AAAGTTCTGGAGATGGATGTTGG - Intronic
977096598 4:92753301-92753323 CAAGATCTGGAGAGAGAGGTAGG + Intronic
978237933 4:106482604-106482626 GAGGAGCGGGAGAAGGAGGTGGG - Intergenic
978740934 4:112137165-112137187 CAGGATCTGGAGAAGTAAGGTGG - Intergenic
978796622 4:112714254-112714276 CAGGAGGTGGAGATGGCAGTGGG - Intergenic
979736405 4:124091271-124091293 CAGGAACTGGACATGGCTGTGGG + Intergenic
980079550 4:128329503-128329525 AGGGGTCTGGAGATGGATGTTGG + Intergenic
980726456 4:136767820-136767842 CAGGCTTTGAAGATGGAGGCAGG - Intergenic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981668905 4:147262546-147262568 CAGGATTTAGAGATGGTGGTAGG - Intergenic
982587773 4:157264380-157264402 CAGGATTTGGAGATGGAAGGAGG - Intronic
982950000 4:161682610-161682632 CAAGATGTGAACATGGAGGTGGG - Intronic
983077486 4:163343883-163343905 CAGGACCTGGAGGCGGCGGTGGG - Intronic
983257140 4:165412599-165412621 CAGGATCTGGAATTGGAGTCTGG - Intronic
983768951 4:171523765-171523787 CAGGAACTGGAGACAGAAGTGGG + Intergenic
983838902 4:172430261-172430283 CATGATGTGGAGAGGGGGGTAGG + Intronic
985477436 5:86190-86212 CAACATCTGGAGAAGGAAGTGGG - Intergenic
985641023 5:1063616-1063638 CAGGAGGTGGAGGTGGAGGTGGG - Intronic
985947765 5:3200257-3200279 CAGCATCTGGAGGTGCAGGCTGG - Intergenic
986132811 5:4946608-4946630 CAGGATCTGGACATGGAGTCTGG + Intergenic
986579449 5:9249724-9249746 AGGGATCTGGAGATGGATGAAGG + Intronic
986785734 5:11112360-11112382 CCGGATCTGAAGATGGTGGAAGG + Intronic
986965425 5:13264679-13264701 CAAACTCTGGAAATGGAGGTTGG + Intergenic
987239026 5:15973488-15973510 CTGGCTTTGGAGATGGAGGAAGG + Intergenic
988957206 5:36331736-36331758 CAGGATCAGAACATGGAGATTGG - Intergenic
989108977 5:37889078-37889100 CTGCCTCTGGAGATGGAGGGAGG + Intergenic
991502242 5:67288737-67288759 AAAGCTCTGGAGATGGATGTTGG - Intergenic
992180510 5:74192798-74192820 CACGAGCTGGAAATGGAGTTGGG - Intergenic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
995687907 5:114791208-114791230 CAGGCTGTGGAGATGGAGAGAGG - Intergenic
996648648 5:125846294-125846316 CAGGGACTGGAGACTGAGGTGGG + Intergenic
997043543 5:130286324-130286346 CAGGATGTTGAGGGGGAGGTTGG + Intergenic
997676985 5:135720369-135720391 GAGGATGTGGAGTTGGTGGTGGG + Intergenic
998024583 5:138804232-138804254 CAGGCTCTGGAGCTGGATATAGG - Intronic
998036392 5:138920525-138920547 CAGGATCTGGCTTTTGAGGTAGG + Intronic
998399227 5:141839488-141839510 CTGGAGCTGGGGCTGGAGGTGGG + Intergenic
998657773 5:144201313-144201335 CAGGATTTGGTGAGGGAGATGGG - Intronic
998888808 5:146724086-146724108 CAGGGTCTGGACATGTAAGTAGG - Intronic
998938023 5:147251270-147251292 CAATATCTGGATATGGAGGTGGG - Intronic
999236370 5:150099702-150099724 CAGGGGCTGGAGATGGAGGGAGG + Intronic
999342282 5:150782464-150782486 CAGGAGCTGGGGACTGAGGTGGG - Intronic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1001656701 5:173356235-173356257 CAGGAGGTGGAGTTGGAGATGGG + Intergenic
1001667242 5:173443482-173443504 CTAGATCTGGGGGTGGAGGTGGG - Intergenic
1001791052 5:174458480-174458502 AAGGATGTGGGGAAGGAGGTGGG - Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002301790 5:178261646-178261668 CAGGAAGTGGAGGTGGTGGTGGG + Intronic
1002517470 5:179770111-179770133 CAGGAGCTGGAGAGGCAGGGTGG - Intronic
1002838660 6:887091-887113 AAGGTTCTGGAGATGGAAGGCGG - Intergenic
1003014279 6:2455538-2455560 CAGGTTCTGGAGATGTGGCTTGG + Intergenic
1003075982 6:2984047-2984069 GACGAACTGGAGCTGGAGGTGGG + Intergenic
1003966253 6:11255427-11255449 CATGATCTGGTGAGGGAGGTTGG + Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005493257 6:26366744-26366766 CAAGGTCTGCAGATGGAGGTGGG - Intronic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1005502502 6:26442122-26442144 CAAGGTCTGCAGAGGGAGGTGGG - Intronic
1005877490 6:30023278-30023300 AAAGTTCTGGAGATGGAGGGTGG - Intergenic
1005988939 6:30891496-30891518 CAGGATATGGAGTTTGGGGTGGG + Intronic
1005999273 6:30952808-30952830 GGGGAACTGGAGATGGAGCTGGG + Intronic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007384789 6:41513147-41513169 CAGGCACTGGAGCTGGAGGTGGG + Intergenic
1008137388 6:47792813-47792835 CAGGGCCTGGAGACTGAGGTGGG + Intronic
1008567354 6:52782645-52782667 CAGGATCTGGAGATCATGGGGGG + Intergenic
1008578199 6:52881768-52881790 CAGGATCTAGAGATCATGGTTGG + Intronic
1008628356 6:53339951-53339973 CAAGATGTGGAGATGGAAGACGG + Intronic
1010254651 6:73744132-73744154 TAGGTTCTGGAGATGGATGGTGG - Intronic
1010392329 6:75351840-75351862 CAGTATCTGTAGCTTGAGGTTGG + Intronic
1011755210 6:90491675-90491697 AAGGTTCTGGAGATGGATGGTGG + Intergenic
1012582000 6:100881036-100881058 GAGGAGGTGGAGGTGGAGGTGGG - Intronic
1013435572 6:110102026-110102048 CAGTGGCTGGAGGTGGAGGTGGG + Exonic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1014009559 6:116460514-116460536 GAGTATCTGGATATGGAGCTTGG - Intergenic
1014384298 6:120781405-120781427 CGTGATGTGGAGATGGGGGTAGG - Intergenic
1014429421 6:121349677-121349699 GAGTAACTGGAAATGGAGGTAGG - Intergenic
1014574512 6:123053693-123053715 AAGCAACTGGAGATGGAAGTAGG + Intronic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1015572865 6:134639721-134639743 TAGGAAGTGGAGATGGATGTTGG + Intergenic
1015961845 6:138658352-138658374 CAGGAGCTGGAGTGGGAGGTAGG - Intronic
1015962177 6:138661280-138661302 CAGGGGCTGGAGTGGGAGGTGGG - Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1016818656 6:148326894-148326916 CAGGATGTGACGGTGGAGGTAGG - Intronic
1016849602 6:148603616-148603638 CAGGAGCTGGAGGTGGAGGGAGG - Intergenic
1017692216 6:156978198-156978220 CAGAGTCTGGAAATGGAGCTGGG - Intronic
1017858417 6:158372309-158372331 GAGGATCTGGAGAAGAAGGAAGG - Intronic
1018433745 6:163743554-163743576 TATGTTCTGGAGATGGGGGTAGG - Intergenic
1018463688 6:164022882-164022904 CAGGATTGGGAGATGGATCTTGG - Intergenic
1018944076 6:168333639-168333661 CAGGACCTAGAGATAGAGGCAGG + Intergenic
1018945045 6:168342030-168342052 CAGGGTCTGGAGGTGGATGGTGG - Intergenic
1019293057 7:259745-259767 CAGGAGCTGCAGACGCAGGTAGG - Exonic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019918223 7:4147054-4147076 CAGGACCTGGAGTGGGAGCTGGG - Intronic
1021597706 7:22334930-22334952 AAGGATGTTGAGATGCAGGTTGG - Intronic
1022286769 7:28961085-28961107 AAGAATCTGGAGATGCAGGCTGG + Intergenic
1022309315 7:29180754-29180776 CAGGCTCTGGAGTTAGAGCTGGG + Intronic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1024055174 7:45655756-45655778 GGGGATCTGGGGATGAAGGTGGG + Intronic
1025499671 7:61270259-61270281 CAGAATCTGCAAATGGATGTTGG + Intergenic
1025514522 7:61616468-61616490 CAGAATCTGCAAATGGATGTTGG + Intergenic
1025538868 7:62045308-62045330 CAGAATCTGCAAATGGATGTTGG + Intergenic
1026381849 7:69808031-69808053 CAGGATCCGGAGGCTGAGGTAGG - Intronic
1026479032 7:70763072-70763094 CAGGGTCCGGAGAAGGAGCTCGG - Exonic
1026571234 7:71532959-71532981 CAGGGTTTGTAGGTGGAGGTGGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027844959 7:83361146-83361168 TAGTATTTGGAGATGGAGTTTGG - Intergenic
1028984565 7:96999325-96999347 CAGGAGGTGGAGATGGGGGTGGG - Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032518621 7:132525707-132525729 GTGGGTCTGGAGATGCAGGTTGG - Intronic
1032800824 7:135316216-135316238 CAGGTGGTGGAGATGGAGGGGGG - Intergenic
1032917849 7:136511661-136511683 GAGGAGCTGGAGAGGGAGGCTGG + Intergenic
1032933162 7:136697499-136697521 CAGAGGCTGGAGATGAAGGTGGG - Intergenic
1033316029 7:140298462-140298484 CAGGAGCTAGAGAGGAAGGTGGG - Intronic
1034276185 7:149824801-149824823 CAGGATTTGAAGCTGGGGGTGGG + Intergenic
1034603311 7:152285297-152285319 CAGGAGCTGGAGTGGGAGGTAGG + Intronic
1034835495 7:154348085-154348107 CAGCATCAGGAGGTGGGGGTGGG - Intronic
1034853097 7:154514480-154514502 AAGGATCTGGAGATGGATGGAGG - Intronic
1034949239 7:155285852-155285874 AAGGGTCTGGAGATGGATGGTGG - Intergenic
1035332609 7:158106155-158106177 AAGGAACTGGAAATGGAGATGGG - Intronic
1035400797 7:158564420-158564442 CACGTCCTGGTGATGGAGGTGGG - Intronic
1035593141 8:833480-833502 CTGGCTTTGCAGATGGAGGTGGG - Intergenic
1035608104 8:942475-942497 CTGGACCTGGAGATGGATTTTGG - Intergenic
1035789524 8:2290974-2290996 AAGGTTCTGTAGATGGATGTTGG + Intergenic
1035803281 8:2430731-2430753 AAGGTTCTGTAGATGGATGTTGG - Intergenic
1036396637 8:8376632-8376654 CAGGACCTTGGGATGGAGGCTGG + Exonic
1037260429 8:17001793-17001815 CAGGATCTGCAGGTGGAAGCCGG + Exonic
1037611943 8:20483274-20483296 CAAGGTCTAGAGATTGAGGTAGG + Intergenic
1037774489 8:21823962-21823984 CAGGAGCTGGAGGTGGAGTCTGG + Intergenic
1037998889 8:23373765-23373787 CAGGATCTGAAGGTGGTGGCAGG + Intronic
1038659637 8:29486131-29486153 CAGGAGCTGGTGATGGAGTGAGG + Intergenic
1038989254 8:32847986-32848008 AAGGTTCTGGAGATGGAGGGTGG - Intergenic
1039721254 8:40167151-40167173 CATGAGCTGGAAATGGAGATAGG + Intergenic
1039887750 8:41664878-41664900 CAGGAGCTGGACAAGGAGCTGGG - Intronic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1042985658 8:74580279-74580301 CTGGCTCTGAAGATGGAGGGGGG - Intergenic
1043414653 8:80034285-80034307 CTGGATCTGGAGCTGCAGCTGGG + Intronic
1044407821 8:91850158-91850180 CAGAATCTGGAAAGGGTGGTTGG + Intergenic
1046138679 8:110062376-110062398 CTGGATAGGGAGATGGGGGTGGG - Intergenic
1046417130 8:113932122-113932144 CAGGAGCTGGAGAGGGAAATGGG + Intergenic
1047002454 8:120586604-120586626 TAGGATCTTGAGATGGAGAGAGG - Intronic
1047874084 8:129115991-129116013 GAGGATGGGGTGATGGAGGTAGG - Intergenic
1047908137 8:129494821-129494843 TAGGATCTTGAGATGGAGAGAGG - Intergenic
1048376485 8:133826858-133826880 CAGGATTTGGAGGTGGTGGCAGG + Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1048700519 8:137083463-137083485 TAGGATCTTGTGATGGGGGTAGG + Intergenic
1049383332 8:142328665-142328687 CACGATCTGGAGATGGTGTGTGG - Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049658910 8:143811024-143811046 CAGGGCCTTGAGATTGAGGTGGG + Exonic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049884181 9:16817-16839 CAGGAGCTGGGGGTGGTGGTGGG + Intergenic
1049984970 9:941594-941616 AAAGTTCTGGAGATGGAGGGTGG + Intronic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050412034 9:5376252-5376274 AATGTTCTGGAGATGGAGGGTGG + Intronic
1052361603 9:27567084-27567106 CAACAGCTGGAGATGGCGGTGGG + Exonic
1052990552 9:34517147-34517169 CTGGAGCTGGAGGTGGAGGGAGG - Intronic
1053241007 9:36495589-36495611 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1055714793 9:79105364-79105386 CAGGAACTGGAGATCAAAGTGGG + Intergenic
1055888462 9:81096141-81096163 CAGGATCTGGAGAATGAATTGGG + Intergenic
1055977496 9:81969259-81969281 TAGGATCTGGGGTTGGTGGTTGG - Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056723930 9:89095512-89095534 AAAGTTCTGGAGATGGAGGGTGG + Intronic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057536480 9:95913662-95913684 CAGGGACTGGAGATGGAAGCAGG - Intronic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1057973388 9:99578628-99578650 CAGTATCTGGAGATGTACTTGGG - Intergenic
1057974464 9:99590008-99590030 CAGGGCCTGGGGATGGGGGTGGG + Intergenic
1060764547 9:126283864-126283886 GAGGCTCTGGAGAAGGAGTTAGG + Intergenic
1060813888 9:126624879-126624901 CAGGCTCCGGGGAGGGAGGTGGG + Intronic
1061223455 9:129266271-129266293 AAGGTTCTGGAGATGGATGGTGG - Intergenic
1061442562 9:130616225-130616247 CAGGAGCTGGAGCTGGATGGAGG + Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1062189835 9:135242319-135242341 CATGCTCTGGAGGAGGAGGTGGG - Intergenic
1062307211 9:135914755-135914777 CACGATCATGAGAGGGAGGTAGG + Intergenic
1062349029 9:136130124-136130146 CGAGTTCTGGAGATGGAGGGTGG - Intergenic
1203780235 EBV:96626-96648 CAGGAGCAGGAGGTGGAGGCCGG + Intergenic
1203790655 EBV:149839-149861 CAGAATCTGCAGGTAGAGGTAGG + Intergenic
1203420634 Un_KI270371v1:1063-1085 CAGAATCTGCAAATGGATGTTGG + Intergenic
1185888210 X:3801843-3801865 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1187094446 X:16131620-16131642 CAGGATCTGTAGGTGGAGGAAGG - Intronic
1187124146 X:16437720-16437742 CAGCATATGGATAGGGAGGTGGG + Intergenic
1191111995 X:56811462-56811484 GGGGATCTGGAGAGGCAGGTTGG + Intergenic
1192181172 X:68916634-68916656 CAGAAACTGGAGCTGGAGTTGGG - Intergenic
1192340611 X:70260237-70260259 AAGGAGGTGGAGTTGGAGGTGGG + Intergenic
1192437421 X:71151559-71151581 CAGGGTCTGGGAATGGTGGTCGG + Intronic
1192819981 X:74635310-74635332 GGGGATGTGGAGATGGGGGTTGG - Intergenic
1192940000 X:75902146-75902168 CAGAATCAGAACATGGAGGTTGG - Intergenic
1193509762 X:82384461-82384483 CAGGATCTGCTGAGGGAGGGAGG + Intergenic
1195047057 X:101063735-101063757 CAGGGTCTGGTGGTGGAGGGTGG - Intergenic
1197728786 X:129793596-129793618 CAGAATATGGGGGTGGAGGTAGG - Intronic
1197831712 X:130649943-130649965 CAGCATCTTGAGCTGGAGTTTGG + Intronic
1198039716 X:132838148-132838170 CAGGATCTGGTGAAGTGGGTGGG - Intronic
1198212898 X:134531653-134531675 AAGGTTCTGGAGATGGATGGTGG - Intergenic
1198556625 X:137800018-137800040 CAATGTCTGGAGATGGAGGAGGG - Intergenic
1200037184 X:153339423-153339445 CAGCATTCGGAGATTGAGGTGGG + Intronic
1200401622 X:156023339-156023361 CAGGAGCTGGGGGTGGTGGTGGG - Intergenic
1201226494 Y:11823910-11823932 CAGGAGGCGGAGGTGGAGGTTGG - Intergenic
1201464127 Y:14261227-14261249 CAGGAGCTGGAGGTGGAGGAAGG - Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic