ID: 943811700

View in Genome Browser
Species Human (GRCh38)
Location 2:192195535-192195557
Sequence TGCTTCCAGGTCGGCAAGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943811700_943811705 14 Left 943811700 2:192195535-192195557 CCGCTCTTGCCGACCTGGAAGCA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62
943811700_943811706 27 Left 943811700 2:192195535-192195557 CCGCTCTTGCCGACCTGGAAGCA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 943811706 2:192195585-192195607 AACCCCAAGGCTGCTCGCCGAGG 0: 1
1: 0
2: 1
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943811700 Original CRISPR TGCTTCCAGGTCGGCAAGAG CGG (reversed) Exonic
900407563 1:2499222-2499244 TGATGCCAGGTGGGCAGGAGTGG + Exonic
901896589 1:12318455-12318477 TGCTTGCAGGTCTGTAAAAGAGG - Intronic
902329971 1:15726517-15726539 TGGTTCCAGGTTGGCTGGAGCGG - Intronic
903293622 1:22330097-22330119 TCCTTCCAGGTGGAGAAGAGAGG + Intergenic
904603963 1:31689000-31689022 TGCTTCCAGGTAGGCAGAGGAGG + Intronic
905263988 1:36738653-36738675 TGTTTCCAGGGTGGCAACAGGGG + Intergenic
906467576 1:46097125-46097147 TGCTTCCAGGAATGCAAGATTGG + Intronic
907891823 1:58644042-58644064 GGTTTCCAGGTAGGCTAGAGTGG + Intergenic
908282334 1:62553618-62553640 TGCTTCAAGGAGGCCAAGAGAGG - Intronic
912836365 1:112999989-113000011 AGCTTCCAGGGAGGGAAGAGGGG - Intergenic
1064994585 10:21285415-21285437 GGCTTCCAGGTAGGCGAGAAAGG - Intergenic
1065197876 10:23284368-23284390 TTTTTCCAGGCAGGCAAGAGTGG - Intronic
1075188602 10:120285728-120285750 TGCTTCAAAGCCAGCAAGAGTGG + Intergenic
1075249338 10:120851519-120851541 AGCTTCCAGGTCGCCAGGATCGG + Intronic
1076836713 10:133024828-133024850 AGCTTCATGGGCGGCAAGAGCGG - Intergenic
1086321445 11:85651828-85651850 TGTTTCCAGGCCAGCAAGATAGG + Intronic
1087678614 11:101191910-101191932 TGCTTCTAGGATGGTAAGAGAGG - Intergenic
1090152652 11:124402067-124402089 TGCTGTCAGGAGGGCAAGAGTGG - Intergenic
1090252509 11:125261766-125261788 TGTTTGCAGATCGGAAAGAGCGG - Intronic
1093105888 12:15086592-15086614 TTCTTCAAAGTCAGCAAGAGTGG + Intergenic
1094809932 12:34126823-34126845 TGCTGGCAGGGTGGCAAGAGTGG - Intergenic
1101697997 12:107144768-107144790 TGCCTCCTCGTCGGCAGGAGGGG + Intergenic
1102007908 12:109600230-109600252 TGGCTCCAGGTCAGCAAGCGTGG + Intergenic
1108622069 13:52194486-52194508 TGCTTTCCGGTGGGCAACAGGGG + Intergenic
1112192741 13:97193661-97193683 GGATTGCAGGTAGGCAAGAGTGG + Intergenic
1114055739 14:18965862-18965884 TGTGTCCAGGCCAGCAAGAGGGG - Intergenic
1114106808 14:19435902-19435924 TGTGTCCAGGCCAGCAAGAGGGG + Intergenic
1119388845 14:74276554-74276576 TGCTGCCAGGACAGCTAGAGTGG + Intergenic
1123499575 15:20867380-20867402 TGTCTCCAGGCCTGCAAGAGGGG + Intergenic
1123556827 15:21441110-21441132 TGTCTCCAGGCCTGCAAGAGGGG + Intergenic
1123593050 15:21878346-21878368 TGTCTCCAGGCCTGCAAGAGGGG + Intergenic
1123696873 15:22884901-22884923 TGCTTCCTGGTCGCTAAAAGGGG - Intronic
1124364850 15:29064163-29064185 TTCTTCCAGGTAGGCAAGCTGGG + Intronic
1126199989 15:45974703-45974725 TGCTTCCTGTTCTGCAAGTGAGG + Intergenic
1130242216 15:82205067-82205089 TGCTTCCTGTTGGGAAAGAGGGG - Intronic
1131504904 15:93008873-93008895 TGCTTCCTCATCTGCAAGAGAGG - Intronic
1202965170 15_KI270727v1_random:168299-168321 TGTCTCCAGGCCTGCAAGAGGGG + Intergenic
1133564303 16:6978662-6978684 AGCTTCCAAGTCGGTAAGAAAGG - Intronic
1136055977 16:27689915-27689937 TGATTTCAGGGCAGCAAGAGAGG + Intronic
1136777340 16:32878986-32879008 TGCTTCCAGCACTGCAGGAGAGG + Intergenic
1136893285 16:33982527-33982549 TGCTTCCAGCACTGCAGGAGAGG - Intergenic
1138335317 16:56248516-56248538 AGCTTCCAGGATGGAAAGAGAGG + Intronic
1138558453 16:57786447-57786469 TGCTTCCAGGGCGCCAAGAATGG + Intronic
1141454815 16:84134146-84134168 TGTTTCCAGATCTGCATGAGAGG + Intronic
1141821171 16:86447064-86447086 TCCTTCCAGGGCTGCAAGGGAGG + Intergenic
1203079753 16_KI270728v1_random:1141095-1141117 TGCTTCCAGCACTGCAGGAGAGG + Intergenic
1143400846 17:6640983-6641005 TGTTTCCGGGTGGGCAAGAGAGG - Exonic
1143432448 17:6897010-6897032 GGTTTCCAGGTGGGCAAGTGAGG + Intronic
1147726661 17:42569823-42569845 TGCTTCCAGGTCAGGAAAGGTGG - Intronic
1158273665 18:55743231-55743253 AGCTTCCAAGTGGTCAAGAGAGG + Intergenic
1163499734 19:17669137-17669159 TGCTTCCAGGAAAGGAAGAGGGG + Intronic
1164011421 19:21206216-21206238 TGCTGGCAGGGTGGCAAGAGTGG - Intergenic
1165049708 19:33133748-33133770 TGCTTGTAGGTCAGCAAGACAGG - Intronic
1167065487 19:47182693-47182715 TGCTCCTCGGTCTGCAAGAGAGG + Intronic
927843988 2:26462014-26462036 TGCTTCCCGGGGGGCAGGAGAGG - Intronic
931140451 2:59452229-59452251 TGCTTCCAGGTCTCCCAGACTGG - Intergenic
932173302 2:69577113-69577135 TGGTTCCCCGTCGGCAAGACTGG - Intronic
933844568 2:86314978-86315000 TGCCTCCAGGTCGGGCACAGTGG - Intronic
936743033 2:115537958-115537980 TACTTCCATGTCGTCATGAGAGG + Intronic
937988111 2:127647699-127647721 TGTTTTCAGGTTGGCAGGAGAGG - Intronic
938337166 2:130510431-130510453 TGTGTCCACGCCGGCAAGAGGGG + Intergenic
938352671 2:130610300-130610322 TGTGTCCACGCCGGCAAGAGGGG - Intergenic
938369837 2:130762188-130762210 TCCTTCCAGGAGGGCAACAGAGG + Exonic
938473917 2:131590465-131590487 TGTGTCCAGGCCGGCATGAGGGG - Intergenic
943811700 2:192195535-192195557 TGCTTCCAGGTCGGCAAGAGCGG - Exonic
945892037 2:215439946-215439968 TTCTTCCAGTTCTGCTAGAGAGG + Intergenic
947022657 2:225698446-225698468 TTCTTCCAGCTGGGCAAGATAGG - Intergenic
947537059 2:230946757-230946779 TTCTTCCAGCTCTGCCAGAGTGG - Intronic
947858929 2:233345071-233345093 GGCTTCCAGGTGGGCACCAGAGG + Intronic
1168999980 20:2161767-2161789 TGCTGCCAGGTGGGCAGGAGGGG - Intronic
1172324391 20:34023316-34023338 TGCTCCCAAGTAGGGAAGAGTGG + Intronic
1173966285 20:47115235-47115257 TGCTTCCCTGGCAGCAAGAGGGG - Intronic
1180474216 22:15688413-15688435 TGTGTCCAGGCCAGCAAGAGGGG - Intergenic
1180854777 22:19038991-19039013 GTCTTCCAGGTCTGCCAGAGAGG + Exonic
1181782331 22:25202176-25202198 TGTTTCCAGGTGGGTGAGAGAGG + Intronic
1182474082 22:30566562-30566584 TGCTTCCAGCCCTGCCAGAGGGG + Intronic
1183006320 22:34905594-34905616 TGCTTCCAGGTAGACAGAAGAGG + Intergenic
1185143153 22:49114729-49114751 TTCTTCCAGGTGTGCAAGGGTGG - Intergenic
951466830 3:23010079-23010101 TGATTGCAAGTGGGCAAGAGGGG - Intergenic
953692793 3:45134004-45134026 TCCTTCCAGGGCAGCAAGAAAGG - Intronic
959961420 3:112302960-112302982 TGCTGGCAGGGTGGCAAGAGTGG + Intergenic
961521776 3:127471204-127471226 TGCTTCCAGCTGGGCTGGAGAGG - Intergenic
963857165 3:150266770-150266792 TGCTTCCAGGTCGCCTAATGAGG + Intergenic
984073539 4:175147115-175147137 TCTTTCCAGGACGGCAAGAGCGG - Intergenic
990516192 5:56533068-56533090 AGCTTCCAGGTAAGCAATAGTGG - Exonic
996968455 5:129333171-129333193 TCCTTCCAGGTCAGGGAGAGTGG + Intergenic
1001449294 5:171811991-171812013 TGCTCCCAGGTGGGAAAAAGAGG - Intergenic
1003133983 6:3418816-3418838 TGCCTCCAGGATGGCAAGGGCGG - Intronic
1005299624 6:24457928-24457950 TGCTGCCAGGCAGGCACGAGAGG + Intronic
1014854814 6:126386735-126386757 TTCTTCCAGGTAGGCACTAGGGG + Intergenic
1017135871 6:151147049-151147071 TGCTTCCAGGCTAGAAAGAGTGG + Intergenic
1017624911 6:156338493-156338515 TGCTTCCTGGTTGTCAAGTGTGG - Intergenic
1020434831 7:8151413-8151435 TGCATCCAGGTCACCAAGAAAGG - Intronic
1021571810 7:22073559-22073581 TGTTTGCAGGTAGGCAATAGAGG + Intergenic
1021571891 7:22074489-22074511 TGCTTGCAGGTAGGCAATAGAGG + Intergenic
1024745402 7:52400162-52400184 TGTTTCCAGGTGGGCAAGCCAGG + Intergenic
1028827915 7:95294916-95294938 TGATTCCAGATCCTCAAGAGTGG + Intronic
1031243132 7:119271067-119271089 TGCTTGCAGGTGGACTAGAGAGG + Intergenic
1033253040 7:139777397-139777419 TGCTTCCAGGGCGGGGAGAGGGG - Intronic
1033785591 7:144726645-144726667 CGCTTCCAGGATGCCAAGAGTGG + Intronic
1038035268 8:23682024-23682046 AGGATCCAGGTGGGCAAGAGAGG + Intronic
1047134465 8:122060259-122060281 TGCTTTCAGGTCCTTAAGAGTGG + Intergenic
1048054585 8:130851397-130851419 GGCTTGCAGGTAGGAAAGAGTGG + Intronic
1049224671 8:141444542-141444564 TGCTGCCAGGCCTGCCAGAGGGG - Intergenic
1049909327 9:250240-250262 TGCTTGCAGTTGGGCAAAAGAGG + Intronic
1051666976 9:19474784-19474806 TGCTTCTGGGTGGGTAAGAGTGG + Intergenic
1052137472 9:24931566-24931588 TTCTTCCAAGTCAGCAGGAGAGG - Intergenic
1055222538 9:73954339-73954361 TCTTTCCAGGACAGCAAGAGAGG + Intergenic
1057556030 9:96088019-96088041 TGCTTCATGGTTGGTAAGAGAGG - Intergenic
1190072294 X:47289393-47289415 TGCTTCTAGGTGGGAAAGAGTGG + Intergenic
1192196733 X:69033747-69033769 AGCATTCAGGTAGGCAAGAGAGG + Intergenic
1194242113 X:91463558-91463580 TTCTTCCAGGTATGCAAGACTGG + Intergenic
1196874766 X:120147329-120147351 TGCTGGCAGGGTGGCAAGAGTGG + Intergenic
1201755878 Y:17484796-17484818 TGCTGGCAGGGTGGCAAGAGTGG - Intergenic
1201845674 Y:18421189-18421211 TGCTGGCAGGGTGGCAAGAGTGG + Intergenic
1202070848 Y:20990230-20990252 TGCTGGCAGGGTGGCAAGAGTGG + Intergenic