ID: 943811701

View in Genome Browser
Species Human (GRCh38)
Location 2:192195544-192195566
Sequence TGCTGCTGTTGCTTCCAGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943811701_943811706 18 Left 943811701 2:192195544-192195566 CCGACCTGGAAGCAACAGCAGCA 0: 1
1: 1
2: 2
3: 28
4: 269
Right 943811706 2:192195585-192195607 AACCCCAAGGCTGCTCGCCGAGG 0: 1
1: 0
2: 1
3: 8
4: 74
943811701_943811705 5 Left 943811701 2:192195544-192195566 CCGACCTGGAAGCAACAGCAGCA 0: 1
1: 1
2: 2
3: 28
4: 269
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943811701 Original CRISPR TGCTGCTGTTGCTTCCAGGT CGG (reversed) Exonic
900494027 1:2968128-2968150 TGCTGCTACTGTTTCCAGGGCGG + Intergenic
900684776 1:3941055-3941077 TGCTTCTGTTGGATCCAGGAGGG - Intergenic
901495015 1:9615810-9615832 TACTACTGTTGCTCCCAAGTTGG - Intergenic
901823375 1:11844734-11844756 TTCTGCTGTTCCTTCCACCTGGG - Intergenic
902103249 1:14011358-14011380 TGCAGCTGTTGCTTTCACGTAGG + Intergenic
903174412 1:21572276-21572298 TGGGGCTGGTGCTTCCAGGATGG + Intronic
903313898 1:22485269-22485291 TGGGGCTGTTGCTTCCACTTTGG + Intronic
906204859 1:43981325-43981347 TGCTGCTGCTGCTAGCAGCTGGG - Exonic
906295059 1:44644621-44644643 CCCTCCTGTTGCCTCCAGGTAGG - Intronic
910266573 1:85344456-85344478 TGCTGCAGTCCCTCCCAGGTGGG + Intronic
910325698 1:86004206-86004228 AACTGCTGATACTTCCAGGTTGG - Intronic
912499196 1:110110732-110110754 TGCCACTGTAGCTTCCAGGCAGG + Intergenic
912924234 1:113899682-113899704 TGTTGCTGTATCTTCCAGGATGG - Intronic
915145554 1:153794182-153794204 TGCTGCTGCTGCTCCCAGGCTGG + Intergenic
917052828 1:170942862-170942884 AGCTGCTATTGCTTGCAGGTGGG + Intronic
917370587 1:174289732-174289754 TGCTGCCGTTGCTCTAAGGTTGG + Intronic
918300374 1:183198552-183198574 TGTTGCTGTTGCTACCATTTCGG - Intronic
918769002 1:188528928-188528950 TGTTCTTGTTGCTTACAGGTCGG - Intergenic
919511504 1:198471599-198471621 TTCTGCAGCTGCTTTCAGGTGGG - Intergenic
919609687 1:199729921-199729943 TGCTGGAGTTGCTTCTAGTTTGG - Intergenic
919742210 1:200988026-200988048 TGGTGCTGTTGCTAGCAGGGTGG + Intronic
920552858 1:206878695-206878717 TTCTGCTGTTACCACCAGGTGGG - Intergenic
921033793 1:211357071-211357093 AGCTGCTCTTCCTTCCAGCTAGG + Intronic
923050586 1:230388820-230388842 TGCTGCTTTTCTTTCCAGGGGGG - Intronic
923119707 1:230978787-230978809 TGCTGCTGCTGCTTCTGGGGCGG - Exonic
1063048165 10:2415621-2415643 TCCACCTGTTGCATCCAGGTTGG + Intergenic
1063094885 10:2900450-2900472 TGCTGCTGCTGCTGCCAGGTAGG + Intergenic
1063965394 10:11342502-11342524 TCCTGGTCTTGCTCCCAGGTAGG + Intergenic
1065231662 10:23604860-23604882 TGCTGGTCTTGCTTCCAGACAGG - Intergenic
1067126141 10:43517361-43517383 TGATGCTGTTACTTGCAAGTTGG + Intergenic
1067187291 10:44041982-44042004 TCTTGCAGTTGGTTCCAGGTAGG + Intergenic
1069624174 10:69857194-69857216 GGCCCCTGTCGCTTCCAGGTTGG - Intronic
1072523616 10:96252376-96252398 TGGTGCTGATGCTACCAGTTGGG + Intronic
1073823907 10:107297741-107297763 TTCTGCAGTTGCTTTCAAGTTGG - Intergenic
1074160957 10:110835997-110836019 TACTGCTGCTGCTGCAAGGTTGG + Exonic
1076449298 10:130545195-130545217 TGTTGCTGTTGCTTCATGGAGGG - Intergenic
1076573650 10:131449466-131449488 TTCTGTTGTTGTTTCCATGTGGG + Intergenic
1076735906 10:132458808-132458830 TGGTGCTGTTGGCTCCAGGGTGG - Intergenic
1079066574 11:17299316-17299338 TGATGCTGATGCTTCCAGTTGGG + Intronic
1081854888 11:46296822-46296844 GGCTGCTGTTTCTAGCAGGTGGG + Intronic
1082010933 11:47449156-47449178 TGCAGCTGTCGCTGCCAGTTGGG + Exonic
1082283703 11:50298464-50298486 GGCTGCTGGGGCTTCCAGGAGGG - Intergenic
1082684970 11:56226705-56226727 TGCTGTTGTTGCTTGTAGCTGGG - Intergenic
1082802324 11:57424359-57424381 GGCTGTTGGGGCTTCCAGGTGGG - Intronic
1083659245 11:64244681-64244703 TATTGCTGTTGCTACGAGGTTGG + Exonic
1083752224 11:64766968-64766990 TGCTGCTGTTGTTGCCATGGGGG + Exonic
1085184788 11:74566371-74566393 TGTTTCTGTTGCTTGCAGGAAGG - Intronic
1085428768 11:76428192-76428214 TGCCTCAGTTTCTTCCAGGTGGG - Intergenic
1086362834 11:86077028-86077050 TGATGGTGTTTCTTCCAGCTTGG + Intergenic
1086747065 11:90441956-90441978 TACTCCTGTAGCTTCCAGCTGGG + Intergenic
1086922689 11:92605337-92605359 TCCTTCTGTCACTTCCAGGTGGG + Intronic
1088312526 11:108475227-108475249 AGCTGCTGTTTGTTTCAGGTAGG - Intronic
1089635228 11:119807655-119807677 TGCTGCTGTTGGCTCCTGGCTGG + Intergenic
1090943058 11:131405588-131405610 TCCTGCAGTTGCCTCCAGGTGGG + Intronic
1091229360 11:133977754-133977776 TGGTGCTGTGGGATCCAGGTGGG - Intergenic
1091977559 12:4837569-4837591 TGCTGCAATTGCTTGCATGTTGG + Intronic
1092083469 12:5736836-5736858 TGCTGCTGTTTCTTTCTCGTGGG + Intronic
1092579400 12:9821635-9821657 TTCTGCTGCTGCCTCCAAGTTGG + Intergenic
1095872017 12:47038699-47038721 TGCAGTTGGTGTTTCCAGGTAGG + Intergenic
1095969896 12:47894456-47894478 AGCTGGAGTTGCTGCCAGGTGGG + Intronic
1098514205 12:71354907-71354929 TGGTTCTGTTGGTTCCAGCTAGG + Intronic
1099200025 12:79664956-79664978 TGCTGCTCCTCCTTCCAAGTTGG - Intronic
1100493114 12:95099988-95100010 TCCTGCTGTTCCTTCCATCTGGG + Intronic
1101340633 12:103839988-103840010 TGTCGCTGTTGCTTCCAAGGAGG - Intronic
1101442471 12:104713960-104713982 TGCTCAAGCTGCTTCCAGGTTGG - Intronic
1101450823 12:104777268-104777290 TGCTTTTGTTGCTTCCAATTTGG - Intergenic
1103563392 12:121804058-121804080 TGCTGCTGCTGCTGCCCGGGAGG - Intergenic
1103723408 12:122986443-122986465 TGCTGCTGCAGCTTCTTGGTGGG + Exonic
1103930119 12:124445569-124445591 TGCTGTCATTGCTTCTAGGTGGG - Intronic
1104162269 12:126191818-126191840 TGCTGCAGGTGGTTCCAGGTTGG - Intergenic
1104385734 12:128350260-128350282 TGCTGCTTTTGCGTTGAGGTGGG + Intronic
1104440764 12:128791664-128791686 TCCTGATGCTGCCTCCAGGTGGG - Intergenic
1104631389 12:130405648-130405670 TGCTGCTGGTGATTCCTGGCAGG - Intronic
1106167657 13:27263053-27263075 TGATGCTGATGCTGCCAGCTGGG - Intergenic
1106698057 13:32199618-32199640 AGTTGGTGTTGCTTGCAGGTAGG - Intronic
1107073453 13:36296779-36296801 TCCTGCTGTTGTTCCCAGGTTGG - Intronic
1107577607 13:41744093-41744115 TGGCACTCTTGCTTCCAGGTGGG + Intronic
1107826442 13:44332736-44332758 TGCTGCTGCTGCCTCCAGCCAGG + Intergenic
1109808313 13:67473235-67473257 TTCTACTGTTACTTCCATGTTGG + Intergenic
1111134881 13:84028080-84028102 TGCTGCTGCTGCTACCAGAAAGG + Intergenic
1111414684 13:87923800-87923822 ACCTGCTTTTGCTTCAAGGTGGG + Intergenic
1111939561 13:94595457-94595479 TGCTGCTGTAGCCTCTTGGTTGG - Intronic
1112439007 13:99411875-99411897 TGGTGCAGTTGCTGCCAGTTGGG + Intergenic
1112805548 13:103160782-103160804 GGCTGCTGATGGTTTCAGGTTGG + Intergenic
1113600805 13:111566870-111566892 TGCTACTGCTGCTTTCAGGCCGG + Intergenic
1113777537 13:112956671-112956693 TGCTGCTGCTGCAGCGAGGTTGG + Intronic
1116900308 14:50356135-50356157 TGATGCTGGTGTTGCCAGGTTGG - Intronic
1117438107 14:55736727-55736749 TGCTGCTGAAGCTTCCATCTGGG - Intergenic
1117464001 14:55974318-55974340 GGCTGCTGTTATTTCCTGGTGGG + Intergenic
1118715411 14:68556346-68556368 GGAGGCTGTTGGTTCCAGGTAGG - Intronic
1119390569 14:74288661-74288683 TGTAGCTGGTGCTCCCAGGTGGG + Intronic
1119651468 14:76387018-76387040 TGCTGCTTTGGCCTCCAGGGTGG - Intronic
1119711393 14:76825020-76825042 TGCTGCTGTTGGATCCAGGCTGG + Intronic
1121504300 14:94464653-94464675 TTCTGCAGGTGCTTCCAGCTTGG + Intronic
1122230245 14:100303394-100303416 TGCTGCTGTTGCTGTCACCTGGG - Intronic
1122500424 14:102194473-102194495 TGCTGCTGCTGCTTCTGGTTTGG + Intronic
1122860662 14:104581003-104581025 TGCTCCTGTTCCTACCTGGTAGG + Intronic
1124580217 15:30946609-30946631 TTCTGTTGTTGGTTCGAGGTGGG + Intronic
1124631982 15:31343244-31343266 TGCTGCTGTTTCTCCCAGGATGG - Intronic
1126410302 15:48366897-48366919 TGTTGCTGAGACTTCCAGGTGGG + Intergenic
1127604065 15:60568343-60568365 TGCTGAAGTTTCTCCCAGGTAGG - Intronic
1128778396 15:70341582-70341604 TGATGCTGTTGCTGCCTGTTGGG - Intergenic
1129183993 15:73894610-73894632 TGCTGCTGCTGCTTCCATGCGGG - Intergenic
1129905802 15:79186401-79186423 TGCTGATGCTGCTTCCAAGCAGG + Intergenic
1130989534 15:88868045-88868067 TGCTGCTGCTGCTGCCATCTTGG - Intronic
1131813830 15:96201849-96201871 GGGTGCTGTTGTTTCCAGGGTGG - Intergenic
1132204985 15:99980364-99980386 TGTTGGTGTTGCCTGCAGGTCGG - Intronic
1132355493 15:101168397-101168419 AGCAGCTGATGCTACCAGGTGGG + Intergenic
1135524747 16:23205797-23205819 TGCTGCTGCTTCTGCCAGGGAGG - Intronic
1135752072 16:25066069-25066091 TGTTGCTGCTGCCCCCAGGTGGG - Intergenic
1135757224 16:25108166-25108188 TGTTGCTGCTGCCCCCAGGTGGG + Intergenic
1136653932 16:31697804-31697826 TGCTGCTGTTGCTGCAGGGATGG - Intergenic
1137292402 16:47060936-47060958 TGGTGGTGTTGCTTTCAGATGGG - Intergenic
1138388533 16:56652976-56652998 TGCTGCTCTTGCTGCCCCGTGGG + Exonic
1139676680 16:68528747-68528769 TGCTGGTGTTGCTGCTTGGTTGG + Intergenic
1139923978 16:70475637-70475659 TGCTGCTGGTGCCTGCAGGGCGG - Exonic
1140280182 16:73546729-73546751 TGCTGCTGTTGCTTCTTTTTCGG + Intergenic
1141091534 16:81133662-81133684 TGCTGCTGTTTCTTCGTGCTCGG + Intergenic
1141397160 16:83715497-83715519 CGCTGCTGCTGCTGCCAGGAAGG - Intronic
1141400802 16:83745233-83745255 TCCTGCTGATGCTTCCTGGAAGG - Intronic
1141668967 16:85481513-85481535 GGCTCCTCTTCCTTCCAGGTGGG + Intergenic
1141679258 16:85534909-85534931 TGCTTGGGTTGCTTCCAGCTGGG + Intergenic
1142489703 17:270262-270284 TTCTGCTGTTACTTGCAGTTTGG - Intronic
1143030031 17:3962815-3962837 TGCTGCTATAGCCTCCAGCTTGG - Intronic
1143880261 17:10024487-10024509 TGATCTTGTTCCTTCCAGGTGGG - Intronic
1145104632 17:20104925-20104947 TGCTTCTGTTGCTGCCAGCCTGG + Intronic
1145234909 17:21201597-21201619 GCCAGCTGTTACTTCCAGGTAGG + Intronic
1147967659 17:44201893-44201915 TGCTTCTGAAGCTTCCAGTTGGG - Intergenic
1148876543 17:50690608-50690630 TGCTGCTGCTGCTGCTCGGTGGG - Intronic
1149996368 17:61408100-61408122 TGCGGCTGCTGCTGCCATGTAGG - Exonic
1151544664 17:74785464-74785486 TGCCTCTGTCGGTTCCAGGTTGG + Exonic
1151885619 17:76921665-76921687 TGCAGCTGTTGCTTCCACAGGGG + Intronic
1152437180 17:80283574-80283596 TGCTGCTGTTTCTTCCTGGCTGG + Intronic
1155026545 18:21945794-21945816 TGCTGGTGTTACCTTCAGGTGGG - Intergenic
1157395048 18:47334535-47334557 TGCTGCTCTTGCTTCCAGCTAGG + Intergenic
1157821021 18:50768526-50768548 TGCTGCTGCTGCTTCTAGATAGG - Intergenic
1161087796 19:2343193-2343215 TGCTGCTTTGTCTTGCAGGTGGG + Exonic
1161492624 19:4570559-4570581 GGATGCAGTTGCTTCCAAGTTGG - Intergenic
1162322126 19:9976720-9976742 TGTAGCTGTTGCTGCCTGGTAGG - Intronic
1163149637 19:15403338-15403360 TGCTGCTGTGGCTCCCAGCAGGG - Intronic
1164758041 19:30704845-30704867 TGCTGCTGCTGCCTTCAGGAGGG + Intronic
1165255985 19:34577538-34577560 TGCTGCCGCTGCTCGCAGGTAGG - Intergenic
1165266579 19:34666777-34666799 TGCTGCTGTTGCTCGTGGGTAGG + Intronic
1166227204 19:41403649-41403671 TGATGCTGGTGCTTCCTGGAGGG + Intronic
1166336353 19:42110430-42110452 TGTTGGTGTTGTTGCCAGGTGGG - Intronic
925297772 2:2789604-2789626 TCCTGCTGGTGCTCACAGGTGGG + Intergenic
927400364 2:22703861-22703883 TGCTGCTACTGCTTCCAGGGAGG + Intergenic
928441556 2:31296409-31296431 TGCTGCTGTTACTTCTATTTGGG + Intergenic
929590567 2:43143073-43143095 TGCTGCTGCTGCCTCCACTTGGG + Intergenic
930357945 2:50345377-50345399 AGCTGCTGGTGCTACCAGGATGG - Intronic
932813249 2:74841804-74841826 TGCTGCTGTAGTTTCCATGGAGG + Intronic
932924105 2:75951213-75951235 TGGTGCTGTTGCTTCCACTAGGG + Intergenic
936521122 2:113212710-113212732 TGCTGCTGTTGCTGCAGAGTCGG - Intergenic
936630129 2:114193056-114193078 TGCTGTTGTCACCTCCAGGTAGG + Intergenic
936814147 2:116439077-116439099 TTCTGCAGTTTCTTGCAGGTTGG - Intergenic
937521074 2:122712650-122712672 TGCTGCTGTAGATACCAGCTTGG - Intergenic
937692896 2:124776415-124776437 TGCTGTTCTTGCTTCCAGGCTGG + Intronic
939811265 2:146835642-146835664 TGCTGCTGTTGCTTATAAGGTGG + Intergenic
941143907 2:161819064-161819086 TGCTGATGTTGCTTATACGTTGG - Intronic
943811701 2:192195544-192195566 TGCTGCTGTTGCTTCCAGGTCGG - Exonic
945028632 2:205643099-205643121 TGCAGCTGCTTCTTCCAGGGAGG + Intergenic
946760007 2:222984131-222984153 TGCTGCTGTTGCTTCTGGTCTGG + Intergenic
947868902 2:233421541-233421563 TGGTCCTGATGCTTGCAGGTTGG + Intronic
948275541 2:236705335-236705357 TGCTGCAGGTCCTGCCAGGTGGG - Intergenic
948508354 2:238446520-238446542 TGCTGCGGTTGATTCCAGTGAGG + Exonic
948531199 2:238606723-238606745 TGCTGCTGCTGCTGCGGGGTTGG - Intergenic
1169011660 20:2256203-2256225 TGCTGCTGTGGCTGCCAGCTGGG - Intergenic
1170460754 20:16574511-16574533 TGCTCCTGTGGCTCGCAGGTGGG - Intergenic
1172387383 20:34543715-34543737 AGCTGCTGCTGCTTCCCAGTCGG + Intergenic
1172652324 20:36512661-36512683 TGTTGCTGTTGCATTCAGGGTGG + Intronic
1173430704 20:42985051-42985073 TCCTGCTGTAGCTCCCAGTTGGG - Intronic
1175609322 20:60337239-60337261 TGCTTCTGTTGATGGCAGGTGGG - Intergenic
1176047957 20:63102523-63102545 TGCTGCTGTTTCTTCCTGGCCGG - Intergenic
1179075035 21:38113059-38113081 TGCTCCTGTTCCTGCCAGTTAGG - Intronic
1179496225 21:41772766-41772788 TGCTGCTGCTTCTTCCTGGGGGG + Intergenic
1180054073 21:45348094-45348116 TGCTGCTGCTGCTGCCTGGCCGG - Intergenic
1180198186 21:46209621-46209643 TCCTGCTGTCTCTTCCAGGCGGG - Exonic
1181052217 22:20243330-20243352 TGCAGATGTGGCTTCCAGGGTGG - Intronic
1181484246 22:23220446-23220468 AGCAGCATTTGCTTCCAGGTTGG + Intronic
1182353376 22:29711122-29711144 ATCTGCTGTTGCTTCCTGGCAGG + Intergenic
1182576629 22:31277191-31277213 TATTGCTGTTGCTACGAGGTCGG - Exonic
1183432717 22:37775266-37775288 TCCTGCTGGTGCCTCCACGTGGG - Exonic
949233134 3:1774877-1774899 TGCTACTGTTCCCTCCAGGCTGG + Intergenic
949507376 3:4740237-4740259 TGCAGCTGTAGCATCCAGCTTGG - Intronic
950408421 3:12818743-12818765 AGCTGCTGTTGTTACTAGGTAGG + Intronic
951245696 3:20339255-20339277 TGCTGCTGATGTTTCGTGGTTGG + Intergenic
952066811 3:29580225-29580247 GGCAACTGTTTCTTCCAGGTGGG - Intronic
952977823 3:38710843-38710865 TGCAGCTGTTGATTCCCGGGAGG - Exonic
953140625 3:40226316-40226338 TGCTGCTGTGCTTTCCAGCTGGG - Intronic
953173529 3:40529061-40529083 TGCTGCTGATTCTTACAGCTTGG - Intronic
953712855 3:45289469-45289491 TGCTGCTGATGCTGCTAGTTTGG + Intergenic
955890359 3:63644030-63644052 TGCTGCTGTGACCTTCAGGTCGG + Intergenic
957404148 3:79755346-79755368 TGATGCTGTTGCTTGTAGATGGG - Intronic
958878180 3:99638847-99638869 TGCTGCTGTTTCTTCCCTGAAGG - Intronic
959309607 3:104717278-104717300 TGCTGCAGTAGCTTCCTGGCAGG + Intergenic
961647580 3:128400709-128400731 TGCTGGCGTTGCTTTCATGTTGG - Intronic
961810636 3:129519715-129519737 TGCCCCTCCTGCTTCCAGGTAGG + Exonic
962314477 3:134350677-134350699 TGGTGCTCTGGCTTCCAGGGAGG + Intergenic
963545689 3:146655480-146655502 TACAGTTGTTGCTTCCAGGATGG - Intergenic
966945823 3:184776580-184776602 TCCTGGCATTGCTTCCAGGTAGG - Intergenic
967280345 3:187816364-187816386 TGATCCTGTTGCTTCCTGGATGG - Intergenic
967692923 3:192497656-192497678 ACCTGCTGTTCCTTCCAGCTGGG + Intronic
968903599 4:3442075-3442097 TGCTGCTGCTGCTGCCACGGGGG + Exonic
969633562 4:8352488-8352510 TGTTCCTGTGGCTTCCAGGAAGG - Intergenic
971260894 4:25055929-25055951 GGCTGCTGTTGTTTCCAGCTTGG - Intergenic
974078394 4:57188773-57188795 TGATGCTGATGCTGCCAGGATGG + Intergenic
974684815 4:65213910-65213932 TGATGCTCATGCTTCCTGGTGGG - Intergenic
975917333 4:79340809-79340831 TGCAGCTGGTGTTTTCAGGTGGG - Intergenic
978125412 4:105129861-105129883 TGCAGCTGTTTCTTGCATGTAGG + Intergenic
978208579 4:106108965-106108987 TTCTGATTTTGCTTTCAGGTTGG - Intronic
978923781 4:114217743-114217765 TGCTGCTGCTGCTGACAGGTGGG + Intergenic
979013046 4:115395884-115395906 TGCCTCTGTTGCCTCCAAGTTGG - Intergenic
980059679 4:128115704-128115726 GGGTGCTGTTGCTGCCATGTTGG + Intronic
980923792 4:139114857-139114879 TATTGCTGTTGCTACGAGGTTGG + Intronic
981747844 4:148068231-148068253 TGCTGCTGCCGCTGCCACGTGGG - Intronic
983431427 4:167656199-167656221 TGCTGCTGTTGGTGGAAGGTTGG - Intergenic
983660665 4:170127918-170127940 GGCTGGTGTGGGTTCCAGGTGGG - Intergenic
983892064 4:173039947-173039969 TGCAGCTGTTGCTCACAGGATGG - Exonic
985395992 4:189545026-189545048 TGCTGCTGTTGTTTGGAGGGAGG + Intergenic
986003453 5:3648466-3648488 GGCTGCTGTTTCTACCAGGAGGG + Intergenic
986011987 5:3724889-3724911 TGCTCATGTGGCTCCCAGGTGGG + Intergenic
990914898 5:60893133-60893155 TGCTGCTGCTGCTTCCAAATGGG - Intronic
992128268 5:73665349-73665371 TCTTGCTCTTGCTTCCAGGCTGG + Intronic
992228144 5:74639032-74639054 TGCTCCTGTATGTTCCAGGTTGG + Intronic
993191288 5:84685231-84685253 TGCTGCTGCTGTTTTCTGGTAGG + Intergenic
997416980 5:133736569-133736591 TGCTCCTTGTGCATCCAGGTTGG - Intergenic
997597243 5:135115189-135115211 TGGTGCTGGGGCTTCCATGTGGG + Intronic
998071133 5:139198563-139198585 GCCTGCTTTTGCTTCCAGGCTGG + Intronic
998107972 5:139480785-139480807 TGCGGCTGATCCTGCCAGGTGGG - Exonic
998178119 5:139914511-139914533 TGAAGCTGTTGCTTGGAGGTGGG - Intronic
1000125576 5:158240503-158240525 TGCTGCTGTATCTTTCAGGAGGG + Intergenic
1001138122 5:169119588-169119610 TGCTGCTGCTGCTGCCAGCCTGG - Intronic
1001259894 5:170219428-170219450 TGGTGCTGTGGCTTCCAGGAAGG - Intergenic
1005808904 6:29501492-29501514 TGCTGCTGCTGCTGCCAGACAGG - Intergenic
1006060764 6:31416874-31416896 TCCTTCTCTTGCTTCCAGGCAGG - Intergenic
1007139629 6:39558206-39558228 TCCTTCTGTTGCTTCCAGACGGG + Intronic
1007292510 6:40798276-40798298 TGCTGCTGCTGATGCCAGGGAGG + Intergenic
1008013190 6:46490838-46490860 ACCTGCTGCTGCTTCCAGGAAGG + Intronic
1008422955 6:51323748-51323770 TACTACTGATGCATCCAGGTGGG - Intergenic
1011516348 6:88158511-88158533 TGCTGCTGATGCTTCTGGTTGGG - Intronic
1015416470 6:132954493-132954515 TGTTCCTGTTGCCTCCAGATAGG - Intergenic
1016393150 6:143594860-143594882 GGCTGCCGTTGCTGTCAGGTGGG + Intronic
1016634186 6:146268383-146268405 TGGTGCTGTTTCTTCTGGGTAGG + Intronic
1016891514 6:149012112-149012134 TGATGCTGATGCTTCCTGGATGG + Intronic
1017787568 6:157769194-157769216 TGCTGCTGTTGCTGCATGGGAGG - Intronic
1018727953 6:166627736-166627758 GGCTGCTCTTTCTTCCAGCTTGG + Intronic
1018825045 6:167402437-167402459 AGCTGCTGTCCCTTCCGGGTGGG + Intergenic
1018969600 6:168517368-168517390 TGCTCCTGATGCTTCCAGAGAGG + Intronic
1019483465 7:1276864-1276886 TCCTCCTTTTGCTTCCAGGTGGG + Intergenic
1019793948 7:3035986-3036008 TGTTTCTGTTGCTTGCAGTTTGG - Intronic
1020766563 7:12329262-12329284 TGCAGATGAGGCTTCCAGGTAGG + Intergenic
1023016229 7:35971074-35971096 TATTGCTGTTGCTACGAGGTCGG + Intergenic
1023270488 7:38456564-38456586 TGCTGCTGGTGCATTCTGGTGGG - Intronic
1023831956 7:44044692-44044714 CGCTGCTGTAGCTTCCGGGCCGG - Exonic
1026574925 7:71564146-71564168 TTCTGCTTCTGCTTCCAGGGAGG + Intronic
1026764980 7:73154793-73154815 TGCTGCTGTTGCTGCCGCGGGGG - Intergenic
1027041452 7:74964563-74964585 TGCTGCTGTTGCTGCCGCGGGGG - Intergenic
1027082188 7:75237813-75237835 TGCTGCTGTTGCTGCCGCGGGGG + Intergenic
1027864455 7:83628995-83629017 TGATGCTATTGCTTCCTGCTTGG + Intronic
1028732782 7:94171408-94171430 TTCTTCTGTGGCTTCCAGTTGGG - Intergenic
1029923049 7:104286703-104286725 TGCTCTTGTTGCTCCCAGGCTGG - Intergenic
1030167956 7:106573425-106573447 TGCTGCTATGACTTGCAGGTAGG - Intergenic
1033368968 7:140691951-140691973 TGCTGCTGCTGTTCCCAGGATGG + Intronic
1034424834 7:151009045-151009067 GCCTGCAGTTGCTGCCAGGTGGG + Exonic
1035672472 8:1430407-1430429 TGCTGATGTTTCTTCAAGGTCGG + Intergenic
1036699537 8:11002824-11002846 TGCTGATGTTTATTCCAGATGGG + Intronic
1036824670 8:11966743-11966765 TGCTGCTGTTATTTGCAAGTGGG - Intergenic
1037715021 8:21390389-21390411 TGCTGCTGCTGCTTCCAGCCAGG - Intergenic
1038123829 8:24648886-24648908 TGCTGCAGTTGCCTCCTGGCAGG + Intergenic
1038131060 8:24732135-24732157 TGCTGCTGTTCCCTTCAGGAAGG - Intergenic
1038240970 8:25807760-25807782 TGGTGCTGTTTCTTGAAGGTTGG - Intergenic
1039181436 8:34871239-34871261 TGCTGCTCTATCTTCCAGCTGGG + Intergenic
1041247381 8:55901690-55901712 TGCTGCTGTAGCTTCCAGGTAGG - Intronic
1041280708 8:56209553-56209575 TGCTGATGTTGGTTCCACGTGGG - Intronic
1041442034 8:57907625-57907647 AGTGGCTTTTGCTTCCAGGTAGG - Intergenic
1042242613 8:66679802-66679824 TTCTGCTGGAGCTTCCAGGGAGG + Exonic
1044596248 8:93961633-93961655 AGCTGTTGTTTCCTCCAGGTGGG + Intergenic
1045082152 8:98638640-98638662 TGCTGCTGTTTCTTCCACCTTGG - Intronic
1045251115 8:100484233-100484255 GGCTGCTGATCCTTCCAGCTCGG - Intergenic
1048876867 8:138843427-138843449 TTCTGCAGTGGCTTCCTGGTTGG + Intronic
1049230840 8:141480354-141480376 TGCTCCTGTTGGGTCCAGCTGGG + Intergenic
1049262152 8:141645609-141645631 TCCTGCTGTTGCCTCCGGCTGGG + Intergenic
1049371435 8:142269766-142269788 TGCTGCTGTTGGTTCTGGGCGGG - Intronic
1049423663 8:142527743-142527765 TGCTGCTTTTACGACCAGGTAGG - Intronic
1050205625 9:3193633-3193655 TGCTGCTCTTTCTTCCATTTAGG - Intergenic
1052626250 9:30980843-30980865 TTCCTCTGCTGCTTCCAGGTTGG + Intergenic
1053169395 9:35868031-35868053 TGCTGCTGTTGCTGCTGGGCGGG + Intergenic
1055090007 9:72353877-72353899 TGCTACTTTTGCTTCAAGTTAGG - Exonic
1055453104 9:76448444-76448466 TGCTGTTGTTGTTTTGAGGTGGG - Intronic
1060102956 9:120856442-120856464 TGCTGCTGTGGCCTCCAGCTTGG - Exonic
1062062276 9:134502903-134502925 TGCTGCTGTTGCCTGCAGCTGGG + Intergenic
1062380909 9:136286123-136286145 CTCTGCTGTTGCTCCCAGCTGGG + Exonic
1185749237 X:2597346-2597368 GGCTGAGGTTGCTTCCAGGATGG + Intergenic
1186369382 X:8930813-8930835 GGCTGCTGTTGCTTCCTCATGGG - Intergenic
1188858924 X:35232833-35232855 AGCTCCTGTTGCTTTCATGTTGG - Intergenic
1189532539 X:41901611-41901633 TGCTGCTGGAGTTTTCAGGTGGG + Intronic
1190146499 X:47896018-47896040 TGCTGTTATTGCTTAAAGGTTGG + Intronic
1190363235 X:49668299-49668321 TGCTGCTGCTGCTGCCACTTGGG + Intergenic
1192232824 X:69277828-69277850 TGCTGCTGCTGCTGCCTGGCTGG - Intergenic
1196138822 X:112238740-112238762 TGTGCCTGTTGGTTCCAGGTTGG - Intergenic
1197883256 X:131191386-131191408 TTCTGCTGTTGATTCCAAGTTGG + Intergenic