ID: 943811702

View in Genome Browser
Species Human (GRCh38)
Location 2:192195548-192195570
Sequence GAGATGCTGCTGTTGCTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943811702_943811705 1 Left 943811702 2:192195548-192195570 CCTGGAAGCAACAGCAGCATCTC 0: 1
1: 0
2: 2
3: 30
4: 287
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62
943811702_943811706 14 Left 943811702 2:192195548-192195570 CCTGGAAGCAACAGCAGCATCTC 0: 1
1: 0
2: 2
3: 30
4: 287
Right 943811706 2:192195585-192195607 AACCCCAAGGCTGCTCGCCGAGG 0: 1
1: 0
2: 1
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943811702 Original CRISPR GAGATGCTGCTGTTGCTTCC AGG (reversed) Exonic
900547373 1:3236366-3236388 GAGAGGCTCCTGTGACTTCCAGG + Intronic
901163307 1:7197257-7197279 GAGATGCTGACATTGCTTCAGGG + Intronic
901186873 1:7379503-7379525 GAGACGCTGGTGTTTTTTCCCGG - Intronic
901457573 1:9372045-9372067 CAGCTGCTGCTGTTGCTGCCGGG + Intergenic
902557786 1:17257124-17257146 GAGAGGCTGCTCTTCCTACCTGG + Intronic
902713530 1:18256698-18256720 GAGCTGCTGCCGTTACCTCCTGG + Intronic
906275025 1:44508960-44508982 GTGATGCTGCTGTGCCCTCCAGG - Intronic
908332430 1:63084038-63084060 TGGATGCTGCTGCTGTTTCCTGG - Intergenic
908910900 1:69071665-69071687 GAGTTGCTGGAGTTGCTTCAGGG + Intergenic
910578575 1:88795686-88795708 GAGATGCTTGTGTTGATTACTGG - Intronic
910927251 1:92410083-92410105 GAGCTGCTGCTGCTGCTTTGGGG - Intergenic
911247477 1:95534908-95534930 GAGCTGCTCCTGGTGCTACCTGG - Intergenic
912760313 1:112360433-112360455 GAAATGGGGCTGATGCTTCCTGG - Intergenic
917262526 1:173186020-173186042 GAGAGGCCGCTTTGGCTTCCAGG + Exonic
918388277 1:184033128-184033150 GAGAGCCTGCTGTTGCTTGTGGG - Intronic
918753536 1:188305866-188305888 TAGAAGCTGGTGTTGCTTCTGGG - Intergenic
921979164 1:221236277-221236299 GTGATTTTGCTGTTTCTTCCAGG + Intergenic
922181900 1:223242423-223242445 GAGATGCTGCTCTTATTTCTTGG - Intronic
922713230 1:227849071-227849093 GAGAGCCTGGTGTAGCTTCCAGG + Intergenic
922738619 1:228003690-228003712 GTCCTGCTGCTGTTCCTTCCAGG + Intergenic
922898966 1:229121683-229121705 GGGGTGCTGCTGTACCTTCCAGG - Intergenic
923253120 1:232195336-232195358 CAGTTGCTAATGTTGCTTCCAGG - Intergenic
924731324 1:246714158-246714180 GCCATGTTCCTGTTGCTTCCAGG - Intergenic
924805523 1:247358538-247358560 GAGATGCTACTTTTGGTTCTTGG - Intergenic
1063094884 10:2900446-2900468 AGGATGCTGCTGCTGCTGCCAGG + Intergenic
1063376679 10:5558347-5558369 GACATGGTGCTGCTGGTTCCGGG - Intergenic
1063682292 10:8200120-8200142 CAGATGGTGCTGTTGGTCCCAGG + Intergenic
1064062902 10:12154156-12154178 TAGACGCTGCTGTCACTTCCTGG + Intronic
1065244926 10:23747333-23747355 GAGATGCATCTTTTGTTTCCTGG + Intronic
1065303844 10:24350208-24350230 TATATGCTGCAGATGCTTCCTGG + Intronic
1065929453 10:30466589-30466611 AAAATGCAGCTGTTGCTCCCGGG - Intergenic
1065963775 10:30754603-30754625 GAGATGCACATGTTCCTTCCTGG + Intergenic
1067896357 10:50184363-50184385 CAAATGATGCTCTTGCTTCCTGG - Exonic
1067952620 10:50757664-50757686 CAAATGATGCTCTTGCTTCCTGG + Intronic
1068224631 10:54091294-54091316 GAGAGGCTGGTGTTTCTGCCAGG - Intronic
1068596007 10:58904221-58904243 GAGTTGCTGCTGCTTCTTCCAGG - Intergenic
1069742236 10:70692183-70692205 GAATGGCTGCTGTTGCCTCCTGG + Intronic
1074501660 10:114030301-114030323 GAGAAGCTGGGTTTGCTTCCTGG + Intergenic
1075268756 10:121030383-121030405 GAGGTGATGCTGTTGCTTGCTGG - Intergenic
1075777916 10:124999953-124999975 GAGGTGCTGCTGTTGACGCCAGG - Intronic
1075915794 10:126165671-126165693 CATATGCTGATGCTGCTTCCTGG - Intronic
1076606473 10:131692813-131692835 GAGATGCTGCAGCTTGTTCCTGG - Intergenic
1077488738 11:2850847-2850869 GAGGGGCTGCTCCTGCTTCCTGG + Intergenic
1078754426 11:14195577-14195599 GTAATTGTGCTGTTGCTTCCAGG - Intronic
1080858339 11:36131269-36131291 GAGATGCGTCTGCTGCTGCCTGG - Intronic
1082283705 11:50298468-50298490 GAGGGGCTGCTGGGGCTTCCAGG - Intergenic
1083648126 11:64185031-64185053 AAAATGCTGCTATTGCTTCTAGG - Intergenic
1084436888 11:69148107-69148129 GAAATACTCCTGTCGCTTCCTGG - Intergenic
1085328402 11:75626392-75626414 GAGTGGCTCCTGCTGCTTCCAGG - Intronic
1085849748 11:80106365-80106387 CACATGCTCCTGTTGCTTCCAGG - Intergenic
1089883318 11:121795493-121795515 GCGCTGCTGCTGTTGCTGCTGGG + Intergenic
1091085323 11:132716119-132716141 GAGCTGCTGCTGAAGCTGCCTGG + Intronic
1095193908 12:39290131-39290153 GAGATGCCGCTGTTCCTTAAAGG - Intergenic
1095417331 12:41990916-41990938 GTGATGCTGATGATGCTTGCTGG - Intergenic
1095695575 12:45140162-45140184 GAGATGGTGCTGCTGCATCTTGG - Intergenic
1096810739 12:54168126-54168148 GAGATGCTGCAGGTGCTTCTAGG + Intronic
1098313844 12:69173763-69173785 CAGATGCTGCTGTTACTTAGAGG + Intergenic
1099666278 12:85633419-85633441 GGTATGCTTCTGTTCCTTCCTGG + Intergenic
1100441995 12:94625724-94625746 GGAATGCTTCTGTTGCCTCCTGG - Intronic
1100816454 12:98391536-98391558 GTGATGAGGCTGGTGCTTCCTGG + Intergenic
1103240934 12:119412805-119412827 TTGATGCTGCTGTTCCTTACTGG + Intronic
1104476955 12:129078577-129078599 AAGATGGCCCTGTTGCTTCCTGG + Exonic
1106006475 13:25774861-25774883 GAGAAGCTTCTGTTGGTTCATGG + Exonic
1107266032 13:38555463-38555485 GAGATGTTTTGGTTGCTTCCAGG + Intergenic
1108691810 13:52865869-52865891 GAAATCCTGCTGTTGCTTCTGGG + Intergenic
1109798038 13:67342153-67342175 GAGATGCTACTTTTGCTCCTTGG + Intergenic
1111225631 13:85266980-85267002 GAGATGGTGCTGGTGCTTTCAGG - Intergenic
1111586819 13:90292314-90292336 GAGATGCTACTTTTGGTTCTTGG - Intergenic
1113577266 13:111403431-111403453 GAGATGCTGCTGCTGAATGCAGG + Intergenic
1113809804 13:113131784-113131806 CAGCTGCTGCTGTTGCTGCATGG - Intronic
1113988851 13:114342303-114342325 GAGAAGCTGCTGCTGCAGCCTGG - Intergenic
1116935650 14:50737281-50737303 AAGAGGCTGCTGTTCCTTGCTGG - Intronic
1117761458 14:59033160-59033182 CAGATGCTGCTGTTGAGTGCAGG + Intergenic
1117891818 14:60430325-60430347 CAGAGGCTGGGGTTGCTTCCAGG + Intronic
1118895643 14:69943252-69943274 CAGATGCTGCTGTTGCTGGCAGG + Intronic
1119651470 14:76387022-76387044 GAGCTGCTGCTTTGGCCTCCAGG - Intronic
1121014108 14:90538043-90538065 GAGATGCCGCGTTTGATTCCAGG - Exonic
1121241397 14:92432600-92432622 GAGTTGCTGCTGTCGGTTCAAGG - Intronic
1122900545 14:104780575-104780597 GAGCTGCTGCTGGTGCCTGCTGG - Intronic
1123100378 14:105793689-105793711 ATGAAGCTGCTGCTGCTTCCAGG + Intergenic
1124126243 15:26940133-26940155 AGGTTGTTGCTGTTGCTTCCGGG - Intronic
1126189866 15:45868078-45868100 GAGCTGCTTGTGTTGCTACCTGG - Intergenic
1126270987 15:46816457-46816479 AAGATGCTGCTGATGTTGCCCGG - Intergenic
1127853503 15:62935637-62935659 GAGCTGCTGCTGGCGCTTCTAGG - Intergenic
1128736148 15:70055065-70055087 GAGATGGGGCTCTTGCTGCCTGG + Exonic
1129102568 15:73279820-73279842 CACATGCTGATATTGCTTCCTGG - Intronic
1129333206 15:74838265-74838287 GAGCTACTGCTGTTGCTGGCAGG - Exonic
1132176566 15:99720609-99720631 GAGATGCAGCTGCAGCTTCCTGG + Intronic
1132219943 15:100097754-100097776 GAGATGCTGAGGCTGCTTGCCGG + Intronic
1132608027 16:801595-801617 CAGAGGCTGCTGTTGCTGCCTGG - Intergenic
1132792391 16:1698966-1698988 GAGATGCTGGATTTGCCTCCCGG - Exonic
1134612726 16:15622964-15622986 GAGCTGCTGCAGCTCCTTCCGGG + Exonic
1134811258 16:17168800-17168822 AAGATCCTGCAGCTGCTTCCTGG - Intronic
1135895710 16:26400354-26400376 AAAATGCTGCTGCTTCTTCCTGG - Intergenic
1136605920 16:31333672-31333694 GAGAAGCTGCTGTGAGTTCCTGG + Intergenic
1137970104 16:52976027-52976049 AAGATCTTGCTGTTGATTCCCGG - Intergenic
1138679123 16:58672326-58672348 GAGCTGCTGCTGCAGCCTCCAGG - Intronic
1140714543 16:77710268-77710290 GTGATGCTGCTGCTGCTACCTGG - Intergenic
1140955591 16:79862005-79862027 GAGATGCTGCCTTTGCAACCTGG + Intergenic
1141249333 16:82340605-82340627 GAGATGGTGCTGCTGATACCCGG - Intergenic
1142123827 16:88400422-88400444 GAGCTCCTGCTGCTGCTCCCAGG + Intergenic
1142504871 17:356913-356935 GAGAGGCTGCTGTGCCATCCAGG - Intronic
1145907980 17:28526716-28526738 GAGATCCTGCTGGAGCTTCCTGG + Intronic
1147318610 17:39632886-39632908 GAGTTGCTGCAGTTCCTTCTTGG - Intronic
1147466205 17:40613183-40613205 GAGGTGCTACTTTTGCTTCCTGG - Intergenic
1148388676 17:47254357-47254379 GGGATGCCGCTGTAGCTTCCTGG + Intronic
1148746530 17:49921283-49921305 GAGATCCTGCTCTTCCTTTCAGG + Intergenic
1151236084 17:72720604-72720626 AAGCTACTGCTCTTGCTTCCTGG - Intronic
1151573419 17:74938635-74938657 GAGTAGCTGCTGCTGCTTCCTGG - Intronic
1152238052 17:79148675-79148697 GACATGAGGCAGTTGCTTCCTGG + Intronic
1152437179 17:80283570-80283592 CTGCTGCTGCTGTTTCTTCCTGG + Intronic
1153976315 18:10271339-10271361 GAGGGGCTGCTGCTGCTGCCTGG + Intergenic
1154021270 18:10665912-10665934 CAGAGGCTCCTGTTGCTGCCTGG - Intergenic
1154086716 18:11312844-11312866 GAGATGCTGGTCTTGATTCCCGG - Intergenic
1155377302 18:25174337-25174359 GTGAAGCTGCTGTTGTCTCCAGG + Intronic
1155627347 18:27849856-27849878 GAGGTGCTGCTGCTGCTGCTGGG + Intergenic
1156295284 18:35783963-35783985 GGGAAGCTGCAGTTGCTGCCGGG - Intergenic
1156988135 18:43373646-43373668 AAGATGCTGATGTTGCTTGTTGG - Intergenic
1157154556 18:45253208-45253230 GTGATGCTGTTGTTGCTGGCTGG + Intronic
1157224538 18:45850362-45850384 GCCATGCTGCTGTAGCCTCCTGG - Exonic
1158239522 18:55361201-55361223 GAGCTGCTCCTGTTCCTTCAAGG + Intronic
1160096648 18:75879285-75879307 GAGATGATGGTGTTACTTCCAGG + Intergenic
1160464662 18:79066472-79066494 GAGATGCTGTTGTTACTGTCAGG + Intergenic
1160464713 18:79067021-79067043 GAGATGCTGTTGTCACTTTCAGG + Intergenic
1161724058 19:5918372-5918394 GAGGGGCTTCAGTTGCTTCCTGG - Intronic
1162322127 19:9976724-9976746 GGGATGTAGCTGTTGCTGCCTGG - Intronic
1164717439 19:30403836-30403858 GGGAGGCTGCTGTTGCCTTCAGG + Intronic
1167373357 19:49098034-49098056 GAGATGCAGCTGATGCCCCCAGG - Intronic
1167404301 19:49294254-49294276 CAGATGATTCTGGTGCTTCCGGG + Intronic
924958940 2:16602-16624 GAGAAGCTGCTGCTGCAGCCTGG + Intergenic
925277022 2:2657389-2657411 GAGATGCTGGTGGGGTTTCCTGG - Intergenic
927428811 2:23009209-23009231 GGGATGCTGATGTTGCTCCAGGG - Intergenic
927443584 2:23138359-23138381 GAGATGTTCATCTTGCTTCCGGG - Intergenic
927646481 2:24880257-24880279 GAGAAGCTGCTCTAGCTGCCTGG - Intronic
930357946 2:50345381-50345403 GAGCAGCTGCTGGTGCTACCAGG - Intronic
930576527 2:53157235-53157257 GCGACTCTGCTGTTGATTCCTGG + Intergenic
931579409 2:63757202-63757224 GAGATGCTCCTTTTGCTTATTGG - Intronic
931604954 2:64042894-64042916 CAAATGTTGCTGTTGCTTTCAGG + Intergenic
931865416 2:66405034-66405056 GAAGTTTTGCTGTTGCTTCCAGG - Intergenic
932158196 2:69437372-69437394 GAGCTGCGGCTGTTGCCGCCGGG - Exonic
932418259 2:71586582-71586604 GAGATGCTGCTTCTGATTGCAGG + Intronic
934857236 2:97736985-97737007 GTGATGCTGCGGCTGCTTCCCGG + Intronic
935350121 2:102145352-102145374 GAAATGCTGCTGGAGCCTCCCGG + Intronic
936653289 2:114454875-114454897 GAGAGGCTGCCTTGGCTTCCAGG - Intronic
937058611 2:118963555-118963577 TACATTCTGCTGTTGCTACCTGG + Intronic
937066163 2:119019669-119019691 GAGATGCTTCTGTTTTTTACTGG - Intergenic
939393805 2:141603136-141603158 CAGATACTGATGTTGCTTCCAGG - Intronic
939896930 2:147802859-147802881 TGGATGCTGCTTTTTCTTCCTGG - Intergenic
940805117 2:158178729-158178751 GGGATACTGCTGTTCATTCCTGG - Intronic
942870118 2:180724662-180724684 AAGATGTAGATGTTGCTTCCAGG - Intergenic
943033308 2:182711536-182711558 CTGGGGCTGCTGTTGCTTCCAGG - Intergenic
943152217 2:184129218-184129240 GAGAAGCAGTTGTTGCTTCTGGG - Intergenic
943811702 2:192195548-192195570 GAGATGCTGCTGTTGCTTCCAGG - Exonic
944842188 2:203635063-203635085 GGGATGCTGTAGTTGCTTCAGGG + Intergenic
947878044 2:233480739-233480761 GGGACGCTGCTGTGGCTTCAGGG - Intronic
948217760 2:236244444-236244466 GATTCTCTGCTGTTGCTTCCTGG - Intronic
1169018460 20:2310639-2310661 GACATCCTGCTGTTTCTTCTGGG + Intronic
1169725584 20:8725826-8725848 TAGCTGGTGCTGTTGTTTCCAGG - Intronic
1169893306 20:10476018-10476040 GAGAAGCTTCTCTTGGTTCCTGG + Intronic
1172026708 20:31953603-31953625 GAGGTGCTGCTGGGGCTTCTGGG - Intergenic
1172464706 20:35147321-35147343 GAGCTGCTGCGGGTTCTTCCGGG + Exonic
1173839221 20:46146289-46146311 GAAATTCTGCTATGGCTTCCAGG - Intergenic
1175993608 20:62802246-62802268 GAGCCGCTGCTGAGGCTTCCAGG - Intergenic
1176038540 20:63052138-63052160 GAGATGCTGCAGGTGCCTACAGG + Intergenic
1176343470 21:5719362-5719384 GAGTCGAGGCTGTTGCTTCCCGG - Intergenic
1176501357 21:7605094-7605116 GAGTCGAGGCTGTTGCTTCCCGG + Intergenic
1176537791 21:8117431-8117453 GAGTCGAGGCTGTTGCTTCCCGG - Intergenic
1177001114 21:15614433-15614455 GAGCTGCTGCTGCTGCATCAAGG + Intergenic
1179053160 21:37906586-37906608 GTGATGCTGCTGCTGGTTCAGGG + Intronic
1179435610 21:41360226-41360248 CAGGTGCTGCAGGTGCTTCCAGG + Intergenic
1179674351 21:42971953-42971975 GACTTGCTGCAGCTGCTTCCTGG + Intergenic
1180054074 21:45348098-45348120 GGGCTGCTGCTGCTGCTGCCTGG - Intergenic
1180217755 21:46336697-46336719 GGGATGTTGCTGCTGCTTCTGGG + Intronic
1180987354 22:19912744-19912766 TAGAGGCTGCTGTGGCTGCCTGG + Intronic
1184387550 22:44184971-44184993 GATATGGTGCTGCTCCTTCCTGG - Intronic
1203242737 22_KI270733v1_random:33786-33808 GAGTCGAGGCTGTTGCTTCCCGG - Intergenic
949392541 3:3578677-3578699 AAGATGCTGTTATTACTTCCAGG + Intergenic
950761311 3:15231050-15231072 GTGATGCTGATGTTGCTGCATGG - Intronic
950933655 3:16816521-16816543 GAGATGGTGTTGTTCCTGCCTGG + Intronic
950975477 3:17238282-17238304 GAGCTACTGCTGTTGCCTCCAGG + Exonic
953760112 3:45679979-45680001 GAGGTTCTGCTGTTGAGTCCTGG + Exonic
953811039 3:46113046-46113068 GAGATGCTACTTTTGGTTCTTGG + Intergenic
954631017 3:52047610-52047632 GCGGTGCTGCTGTTGCTCCTGGG - Intergenic
955966591 3:64395511-64395533 TAGATGCTACTGCTGCATCCTGG + Intronic
957024716 3:75168213-75168235 GAGATGCTGCAGATATTTCCAGG - Intergenic
958991647 3:100852855-100852877 GTGATGCTGTTTTTGCTTGCAGG - Intronic
959240547 3:103786565-103786587 GATGTGCTGCTGTTGCTTCCTGG + Intergenic
960054725 3:113269016-113269038 GAGATGCTGCTGTTCCATCCAGG + Intronic
960279849 3:115769015-115769037 GAAATTCTCCTGTTGCTTTCAGG - Intergenic
962145779 3:132838390-132838412 GAAATTCTGTTGTTCCTTCCTGG - Intergenic
962262889 3:133926287-133926309 GGGATGCTCCTGCTGCTTGCTGG + Intergenic
962756350 3:138468042-138468064 GAGATGCTACTGATGCTCTCTGG - Intronic
963138548 3:141929503-141929525 CAGGTGCTGCTGTTGCTTCAAGG + Intergenic
963518558 3:146337325-146337347 GAGATGCTACTTTTGGTTCTTGG - Intergenic
963593011 3:147286620-147286642 GAGATGTGGCTGTGGCTTCAGGG - Intergenic
964126549 3:153239830-153239852 TAGTTGATGCAGTTGCTTCCTGG + Intergenic
964310707 3:155388643-155388665 GAGCTGCTGCTGTGGCTTGGTGG + Intronic
964508337 3:157423351-157423373 GTGCTGCTGCTATTGCTTCAAGG - Intronic
967214239 3:187197201-187197223 CAGATGCTGATGATGCCTCCAGG + Intergenic
967511918 3:190322409-190322431 TAGAAGCTGCGGTTGCTCCCAGG + Exonic
967627538 3:191703384-191703406 CAGCTGCTGCTGCTGCTGCCAGG + Intergenic
968333464 3:197892389-197892411 TAGATGCTGCTGCTGCTGACGGG - Intronic
968474174 4:795375-795397 GGGATGCAGCTCATGCTTCCAGG - Intronic
969493751 4:7514350-7514372 AAGAGGCTGCTGCTGCTTCCTGG + Intronic
970484341 4:16509151-16509173 TAGATGCTGCTGTTGCACACTGG - Intronic
971169025 4:24214317-24214339 GCAATACTGCTGTTGTTTCCAGG - Intergenic
971946532 4:33286351-33286373 GCAATGCTGCTGCTGCTCCCAGG + Intergenic
972224841 4:37000850-37000872 CAGATGCTGGTGTGGCTTACAGG - Intergenic
972345966 4:38192593-38192615 GAGATGCTCCTGTCTTTTCCTGG + Intergenic
972511280 4:39770595-39770617 GAGAGCCTGCTGTTGACTCCGGG - Intronic
972583120 4:40412678-40412700 GAGATGGTGCTGCTGGTTCCTGG - Intergenic
979284751 4:118909709-118909731 GAGATGCTGCATCTGCTGCCGGG + Intronic
981509477 4:145539989-145540011 TAGGTGCTGCTGCTGCTCCCAGG - Exonic
981748499 4:148072542-148072564 GAGAAGCTGCTGTTGGTGCAAGG + Exonic
982239243 4:153282148-153282170 GAGATGATGCTGGTGCGGCCTGG - Intronic
982910108 4:161129932-161129954 GTGGTGCTGCTGCTGCTTCAGGG - Intergenic
984293231 4:177821991-177822013 GAGATGCTTTTGATGGTTCCAGG - Intronic
984866426 4:184284219-184284241 GACAGGCTCCTGATGCTTCCCGG + Intergenic
984909157 4:184655640-184655662 GAGATTCTGGTTTTCCTTCCAGG + Intronic
985020706 4:185686598-185686620 GAGGTGATGTTATTGCTTCCAGG + Intronic
985281460 4:188290568-188290590 CAGATGCTGCTGCTGGTTCATGG + Intergenic
985628444 5:1002322-1002344 GAGTTGCTGCTCTCACTTCCAGG - Intergenic
985828931 5:2213593-2213615 GAGGTGCTGCAGGTCCTTCCGGG - Intergenic
989598003 5:43175006-43175028 CAGATGCTGCTGAGGCTGCCAGG + Exonic
993838400 5:92844576-92844598 GAGATGCTTCTCTTGATCCCTGG - Intergenic
994099288 5:95876753-95876775 CAGGTGCTGCTGTTGCTGCCGGG + Intergenic
994333501 5:98536362-98536384 GATATTCTGCAGTTGTTTCCAGG + Intergenic
995004086 5:107170144-107170166 GAGATGCTGCTGACTATTCCTGG + Intergenic
995746988 5:115414564-115414586 GGGCTGCTGCTGTGGCTTCCTGG + Intergenic
1000397547 5:160791559-160791581 GACTTTCTGCTGTTACTTCCAGG + Intronic
1000651455 5:163822872-163822894 ACCATGCTGCTGTTGCTGCCAGG + Intergenic
1001017392 5:168153805-168153827 GAGATGCTGCTGCTGGTCCCAGG + Intronic
1001259895 5:170219432-170219454 TGGATGGTGCTGTGGCTTCCAGG - Intergenic
1001513061 5:172337150-172337172 GAGATGCAGCTGTTGAGTCCAGG + Exonic
1004211701 6:13652917-13652939 GAGATGCTGCCATTGTCTCCAGG + Intronic
1005735944 6:28746250-28746272 GAGCCGGGGCTGTTGCTTCCCGG - Intergenic
1005796459 6:29367244-29367266 GAAATGCTTCTGTCCCTTCCTGG + Intronic
1006136732 6:31900458-31900480 GAGGGCCTGCTGTTGATTCCCGG - Exonic
1007487270 6:42189719-42189741 AAGAAGGTTCTGTTGCTTCCTGG - Intronic
1007533297 6:42562364-42562386 GAGATGTTGTTTTTGCTTCTAGG + Intergenic
1008127695 6:47687560-47687582 GAGCTGCTGCTACTGCTGCCTGG + Intronic
1011021568 6:82819324-82819346 GAGATGCTGATGCTGCTGTCTGG + Intergenic
1013455975 6:110330069-110330091 GGGCTGCTCCTGGTGCTTCCTGG - Intronic
1015093820 6:129390302-129390324 GTGATGCTGCTGCTGCTTATAGG + Intronic
1016568766 6:145489734-145489756 CAGATGCTGCTGAGGCTGCCAGG - Intergenic
1017013415 6:150080764-150080786 GTCATGCTGCTGGTGCGTCCTGG - Intergenic
1017281995 6:152636121-152636143 GTCATGGTGCAGTTGCTTCCCGG - Intronic
1017991528 6:159493276-159493298 GAGACGCTGCTGGGGCCTCCAGG - Intergenic
1018242913 6:161795649-161795671 GGGATGCAGCTGTTGCTCTCAGG + Intronic
1018557289 6:165062679-165062701 GCGATGCTGCTGTTTCCTCCCGG + Intergenic
1019415436 7:924692-924714 GGGCTGCTGCTGTTGGGTCCTGG - Intronic
1020403032 7:7799353-7799375 GTGATTCTGCAATTGCTTCCAGG + Intronic
1021040403 7:15855313-15855335 GAAATGCTGCTGTTGGTCACTGG - Intergenic
1021522203 7:21549581-21549603 GAGATGCTACTTTTGGTTCTTGG + Intronic
1023002461 7:35824378-35824400 GGGATGTTGGTGTTGCTTCTTGG + Intronic
1023831958 7:44044696-44044718 GCGCCGCTGCTGTAGCTTCCGGG - Exonic
1023904368 7:44512036-44512058 GAGGGGCTGCTGTTGCTTTGAGG - Intergenic
1026386837 7:69858248-69858270 TAGTTGCTGCTGTTGGTTTCAGG + Intronic
1026992408 7:74594601-74594623 GATATGCTGCTGCTGCTGCTGGG - Intronic
1027209169 7:76130457-76130479 GTGATGCTGCTGCTGCTGTCTGG - Intergenic
1028850003 7:95527613-95527635 GAGATGGCACTGTTGCTTCAAGG + Intronic
1030268350 7:107643972-107643994 GAGATGCTGGTGATACATCCTGG + Intergenic
1030891648 7:115006128-115006150 GGGATGCTGCCCTTGCCTCCAGG + Intronic
1030971953 7:116068749-116068771 GATTTTCTGCTGTTGCTTTCTGG - Intronic
1031236667 7:119186688-119186710 GAGCTGATGTTGTTGATTCCAGG + Intergenic
1032463813 7:132130894-132130916 GAGATGCTGCAGTTACCTGCAGG + Intronic
1032606503 7:133360482-133360504 GAGTTGGAGCCGTTGCTTCCAGG + Intronic
1037624269 8:20593816-20593838 GAGATGCAGTTGTTGATTTCGGG + Intergenic
1038398987 8:27268776-27268798 GTGCTGCTGCTGCTGATTCCTGG - Intergenic
1039231040 8:35448502-35448524 CAGGTGCTGCTGATGCTGCCTGG - Intronic
1039886918 8:41660078-41660100 GAGTAGCTGCTGTTGGGTCCTGG - Intronic
1040471628 8:47738857-47738879 GAGACGCGGCTGCTGCGTCCTGG + Exonic
1040818409 8:51533015-51533037 GAGTTGCTGCTGTGGCTGTCAGG - Intronic
1040878950 8:52183171-52183193 GAGAGGTTGCTGTTTCATCCAGG - Intronic
1041247382 8:55901694-55901716 GCAGTGCTGCTGTAGCTTCCAGG - Intronic
1042222402 8:66486503-66486525 GAGATGCTGATGCTGCTCTCTGG + Intronic
1042540922 8:69906297-69906319 CAGAAGCTGCTGTTCCTTGCAGG - Intergenic
1043060086 8:75489083-75489105 GAGATGCTATTGTGGCTTCTGGG - Intronic
1044712156 8:95068316-95068338 GATATCCTGGTGCTGCTTCCAGG - Intronic
1046604172 8:116352291-116352313 GAGATGTTGGTGTTGCTTGTGGG - Intergenic
1047150796 8:122260646-122260668 GAGATGCTACATATGCTTCCAGG - Intergenic
1047425296 8:124739834-124739856 GGGATGGTGCTGTTGGCTCCAGG + Intergenic
1047972195 8:130094727-130094749 GAAATGCTGCTCTGGCTTTCAGG - Intronic
1048909437 8:139120501-139120523 GAGGTGCTGATGTTGCTTGCTGG + Intergenic
1049024727 8:139980540-139980562 GTGATGGTGCTGTTACCTCCTGG - Intronic
1049277035 8:141725121-141725143 CAGATGGGGCTGTTGCTGCCTGG - Intergenic
1049782730 8:144436202-144436224 GAGCTGCTGCTGCTGCTGGCTGG + Exonic
1049816297 8:144604190-144604212 GAGGTGCAGCTGCTGCCTCCCGG - Intronic
1050029851 9:1374396-1374418 GAGCTGCAGCTGCTGCCTCCAGG - Intergenic
1050731494 9:8714455-8714477 TAAATACTCCTGTTGCTTCCAGG + Intronic
1052223105 9:26051697-26051719 GAGATTCTTCTGTTTGTTCCTGG - Intergenic
1053258917 9:36644078-36644100 GTGACGCTGCTGTTGCTTTCAGG - Intronic
1054964287 9:71004426-71004448 GCCATTCTGCGGTTGCTTCCCGG - Intronic
1056361121 9:85858683-85858705 ATCATGCTGCTGTTTCTTCCTGG + Intergenic
1056364256 9:85887244-85887266 CAGATGCTGCTGATGCTGCTGGG + Intergenic
1057081864 9:92179451-92179473 GAGATGCTGCTGATGTGTCAAGG + Intergenic
1057217031 9:93234780-93234802 CAGCTGCGTCTGTTGCTTCCGGG + Intronic
1059332811 9:113546790-113546812 GAGCTGCTGCTGTAGGTTGCGGG + Intronic
1061146766 9:128804223-128804245 TAGCTGCTGCTGCTGCTGCCCGG + Intronic
1061453041 9:130678843-130678865 GAGATGGTCCTCCTGCTTCCTGG + Intronic
1062161241 9:135081333-135081355 GAGGTGCTGGTGCTGCTGCCGGG + Intronic
1062528870 9:136991092-136991114 CACATGCTGCTGTTTCTGCCTGG - Intergenic
1203459063 Un_GL000220v1:16869-16891 GAGTCGAGGCTGTTGCTTCCCGG - Intergenic
1186637892 X:11426280-11426302 GAGCTGCTCCAGTTGGTTCCTGG - Intronic
1186705830 X:12138575-12138597 GAGGCGCTGCTCTGGCTTCCCGG - Exonic
1186979982 X:14948324-14948346 GAGATGCTGATGTTGATCCAGGG + Intergenic
1187053210 X:15714735-15714757 GACATGCTGATCTTGCTGCCAGG - Intronic
1188417209 X:29950494-29950516 GAGATGCTGCTGCTGATTGAGGG - Intronic
1189627814 X:42918235-42918257 GAGATGCTGCTGAAGTATCCAGG - Intergenic
1189906634 X:45767313-45767335 GAGATACTTATGTTGCTTCATGG + Intergenic
1189967669 X:46391331-46391353 CAGATGCTGCTGCTGCTGCTGGG - Intergenic
1190247485 X:48700143-48700165 GAGATTCTGCCGTGGCTCCCAGG - Exonic
1192232825 X:69277832-69277854 AAGTTGCTGCTGCTGCTGCCTGG - Intergenic
1192580418 X:72276921-72276943 GAGAAGCTGCTTTTCCTCCCGGG - Intronic
1193593676 X:83420215-83420237 GAGGTGGTGCTGTTGCTTGGAGG - Intergenic
1193601635 X:83513674-83513696 GAGATGTTGGTGTTTCTGCCTGG + Intergenic
1193821606 X:86171700-86171722 CACATGCTGCTGTTGCTGCTGGG + Intronic
1198574715 X:137997587-137997609 AAGATGCTGCTGCTGCTTTGTGG - Intergenic
1199439075 X:147848120-147848142 CAGATACTGCTATTCCTTCCTGG + Intergenic
1199783664 X:151084755-151084777 GGGATTCTGCTCTTGCCTCCTGG + Intergenic