ID: 943811705

View in Genome Browser
Species Human (GRCh38)
Location 2:192195572-192195594
Sequence CACAAGAGCGTGCAACCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943811700_943811705 14 Left 943811700 2:192195535-192195557 CCGCTCTTGCCGACCTGGAAGCA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62
943811702_943811705 1 Left 943811702 2:192195548-192195570 CCTGGAAGCAACAGCAGCATCTC 0: 1
1: 0
2: 2
3: 30
4: 287
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62
943811701_943811705 5 Left 943811701 2:192195544-192195566 CCGACCTGGAAGCAACAGCAGCA 0: 1
1: 1
2: 2
3: 28
4: 269
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943811705 Original CRISPR CACAAGAGCGTGCAACCCCA AGG Exonic