ID: 943811705

View in Genome Browser
Species Human (GRCh38)
Location 2:192195572-192195594
Sequence CACAAGAGCGTGCAACCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943811700_943811705 14 Left 943811700 2:192195535-192195557 CCGCTCTTGCCGACCTGGAAGCA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62
943811702_943811705 1 Left 943811702 2:192195548-192195570 CCTGGAAGCAACAGCAGCATCTC 0: 1
1: 0
2: 2
3: 30
4: 287
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62
943811701_943811705 5 Left 943811701 2:192195544-192195566 CCGACCTGGAAGCAACAGCAGCA 0: 1
1: 1
2: 2
3: 28
4: 269
Right 943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943811705 Original CRISPR CACAAGAGCGTGCAACCCCA AGG Exonic
903780693 1:25818278-25818300 CCCAAGAGGGAGCCACCCCATGG - Intronic
905956656 1:42002711-42002733 TACAGGAGAGTGGAACCCCAGGG - Intronic
907874569 1:58473161-58473183 CCCAAGAGCTTGCAAGGCCAAGG + Intronic
908010350 1:59769845-59769867 CACAAGATCCTTCAACCACAAGG - Intergenic
909675710 1:78237144-78237166 CACAATGGCTTGCAACCCAATGG + Intergenic
916444266 1:164857352-164857374 CACAGGAGCCTCTAACCCCATGG + Intronic
919921052 1:202166635-202166657 CACAAGAGCGTGGTACCACATGG + Intergenic
920659236 1:207901394-207901416 CACAAGGGTGTACACCCCCAAGG + Intronic
1064441040 10:15353942-15353964 CAGATGAGCGTGCATGCCCACGG - Intronic
1068965824 10:62911374-62911396 CAAAAATGCTTGCAACCCCAGGG + Intronic
1084110816 11:67013298-67013320 CACAAGAGCTTGCATGGCCAGGG - Intronic
1089184891 11:116608129-116608151 CACTAGAGTCTGCAAACCCAAGG - Intergenic
1107350222 13:39506431-39506453 CAGAAGAGCGTGAAATCCCATGG - Intronic
1107620561 13:42224751-42224773 CAAAAGAGAGTACATCCCCAAGG - Intronic
1110438241 13:75498736-75498758 CACTACAGCGTGAAACTCCAGGG - Intergenic
1121626154 14:95386756-95386778 CACAGGAGGGAGCAGCCCCAGGG - Intergenic
1122864336 14:104596737-104596759 CACAAGAGCGATCATCCCTAGGG - Intronic
1126455723 15:48859956-48859978 CACTAGAGCCTGCAACCCCTGGG - Intronic
1132540331 16:505460-505482 CAGAAGGGCCTGCACCCCCAAGG - Intronic
1135004700 16:18809355-18809377 CACCATGGCCTGCAACCCCAGGG - Exonic
1138297206 16:55897175-55897197 GCCAAGAGCATCCAACCCCAGGG + Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG + Intronic
1143629968 17:8133419-8133441 CACAGAGGCGTGCAACCACACGG - Intergenic
1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG + Intronic
928260191 2:29759687-29759709 CACAAGATCATGCAACCCAAAGG - Intronic
928318934 2:30268196-30268218 TACAGTAGTGTGCAACCCCAAGG + Intronic
932442033 2:71743555-71743577 CTCAGGACCGTGCAAGCCCATGG + Intergenic
933778550 2:85786507-85786529 CAGAGGAGCCTGCCACCCCAGGG + Intronic
934460514 2:94211899-94211921 ACCTAGAGCGTGCAACACCACGG + Intergenic
939838588 2:147158829-147158851 CCCAAGAGGGTGCAACCCCAGGG - Intergenic
939870529 2:147521357-147521379 CACATGAAAGTGCCACCCCAAGG + Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
1169603482 20:7289386-7289408 CAAAAAAGCATGCATCCCCAGGG - Intergenic
1170708505 20:18767588-18767610 CCCAAGTCTGTGCAACCCCATGG - Intergenic
1177962526 21:27685098-27685120 CACAAGAAAGTACAAACCCAAGG + Intergenic
1179392103 21:41003452-41003474 GACAACAGCCTGCAGCCCCAGGG + Intergenic
1181692198 22:24569872-24569894 CACAAGAGCTTCTAGCCCCATGG + Intronic
1183866165 22:40705929-40705951 CACAAGAGCTTCCATCCCCTTGG + Intergenic
952455169 3:33465906-33465928 CACAACAGGGTGCAACCCATGGG + Intergenic
952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG + Intronic
955377648 3:58411426-58411448 CACAACAGCATTCACCCCCAAGG - Intronic
969308352 4:6338356-6338378 CACAACACCGTGCAACACCCAGG - Intronic
970509669 4:16768935-16768957 CACGAAAGAGTTCAACCCCAAGG + Intronic
975322217 4:73021577-73021599 CACAAGAGGGTAAAACCTCAGGG - Intergenic
978923657 4:114217083-114217105 CACAAGAGCTTGGGGCCCCAAGG - Intergenic
979460314 4:120975142-120975164 CACAAGAGCGTAGAAGACCAAGG - Intergenic
981216954 4:142181116-142181138 CATAAGAGCTTGCAAACCTAAGG + Intronic
994562593 5:101395191-101395213 CACAAGAAAGTGCCACCACATGG - Intergenic
1002332693 5:178455393-178455415 CACAGCAGGGTGGAACCCCAGGG + Intronic
1002539177 5:179894574-179894596 AACAAGAACCTGCAGCCCCAGGG - Exonic
1002817456 6:693612-693634 CACTGGAGTGTGCATCCCCAGGG + Intergenic
1004551157 6:16648487-16648509 CAAAAAAGTTTGCAACCCCATGG + Intronic
1005169314 6:22964197-22964219 CACAAGAGAATGCAACCCAAAGG + Intergenic
1010011428 6:71051864-71051886 CTCAAGAGTGTACAGCCCCAGGG - Intergenic
1010221493 6:73452285-73452307 CACAAGAGTCTGCGACCCGAAGG + Intergenic
1012784545 6:103606774-103606796 CACCAGAGCGTTCAACTCCTGGG + Intergenic
1014737704 6:125113276-125113298 CACAAGGGCCTGCAACACCATGG - Intergenic
1017015337 6:150095182-150095204 CACAAGCACGTGGAAGCCCATGG - Intergenic
1018836098 6:167485345-167485367 TACAGGAGTGTGCAGCCCCACGG + Intergenic
1034636304 7:152569940-152569962 CAGAAGAGCTGGCAAACCCATGG - Intergenic
1056970039 9:91194017-91194039 AGCAAGCGTGTGCAACCCCAAGG - Intergenic
1059320521 9:113464844-113464866 CAGAAGAGCCAGGAACCCCAGGG - Intronic
1061796222 9:133087287-133087309 GCCGAGAGGGTGCAACCCCAGGG + Intronic
1190356038 X:49605766-49605788 CACAGGCGCGTGCCACCACAAGG - Intronic
1191750478 X:64536772-64536794 CAAAAGAGCCTATAACCCCATGG + Intergenic
1196692111 X:118571104-118571126 CACAAAAGGCTGGAACCCCATGG - Intronic
1200708677 Y:6464752-6464774 CCTAAGAGAGAGCAACCCCAGGG + Intergenic
1201025435 Y:9699957-9699979 CCTAAGAGAGAGCAACCCCAGGG - Intergenic
1202148387 Y:21823145-21823167 CCCAGGAGAGAGCAACCCCAAGG - Intergenic