ID: 943818692

View in Genome Browser
Species Human (GRCh38)
Location 2:192290459-192290481
Sequence AAACCCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943818691_943818692 10 Left 943818691 2:192290426-192290448 CCATAATCTAATTTTGGTAGCTG No data
Right 943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG No data
943818689_943818692 25 Left 943818689 2:192290411-192290433 CCTGAAGTGTCTACTCCATAATC No data
Right 943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943818692 Original CRISPR AAACCCTGCTTCACAAAGAT AGG Intergenic