ID: 943820217

View in Genome Browser
Species Human (GRCh38)
Location 2:192313232-192313254
Sequence TAATTTTTGCAGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943820215_943820217 -5 Left 943820215 2:192313214-192313236 CCTAAAAAATAGTGATGATAATT No data
Right 943820217 2:192313232-192313254 TAATTTTTGCAGAAAGTGGAAGG No data
943820214_943820217 3 Left 943820214 2:192313206-192313228 CCTAAGTACCTAAAAAATAGTGA No data
Right 943820217 2:192313232-192313254 TAATTTTTGCAGAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943820217 Original CRISPR TAATTTTTGCAGAAAGTGGA AGG Intergenic
No off target data available for this crispr