ID: 943820656

View in Genome Browser
Species Human (GRCh38)
Location 2:192315699-192315721
Sequence GGGACCTGCCCACTCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943820641_943820656 27 Left 943820641 2:192315649-192315671 CCGGGTCCCCAGCCTTCAGGCCA No data
Right 943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG No data
943820654_943820656 -4 Left 943820654 2:192315680-192315702 CCTGAAAGTGGGGCCTCTGGGGA No data
Right 943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG No data
943820642_943820656 21 Left 943820642 2:192315655-192315677 CCCCAGCCTTCAGGCCACTTGCT No data
Right 943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG No data
943820644_943820656 19 Left 943820644 2:192315657-192315679 CCAGCCTTCAGGCCACTTGCTGG No data
Right 943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG No data
943820648_943820656 7 Left 943820648 2:192315669-192315691 CCACTTGCTGGCCTGAAAGTGGG No data
Right 943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG No data
943820646_943820656 15 Left 943820646 2:192315661-192315683 CCTTCAGGCCACTTGCTGGCCTG No data
Right 943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG No data
943820643_943820656 20 Left 943820643 2:192315656-192315678 CCCAGCCTTCAGGCCACTTGCTG No data
Right 943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943820656 Original CRISPR GGGACCTGCCCACTCTGCCC AGG Intergenic
No off target data available for this crispr