ID: 943821403

View in Genome Browser
Species Human (GRCh38)
Location 2:192327211-192327233
Sequence CAGGGTAATCCTAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943821392_943821403 -3 Left 943821392 2:192327191-192327213 CCTCTGAGCCATAATCCCCTCAG No data
Right 943821403 2:192327211-192327233 CAGGGTAATCCTAAGGGGGCAGG No data
943821391_943821403 24 Left 943821391 2:192327164-192327186 CCAATGTATCAGCATTTTGAGGC No data
Right 943821403 2:192327211-192327233 CAGGGTAATCCTAAGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943821403 Original CRISPR CAGGGTAATCCTAAGGGGGC AGG Intergenic
No off target data available for this crispr