ID: 943824324

View in Genome Browser
Species Human (GRCh38)
Location 2:192369926-192369948
Sequence ACATCGGAGAAAATTCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943824322_943824324 17 Left 943824322 2:192369886-192369908 CCTAGGGGAGTGGGGTGAGGGTT No data
Right 943824324 2:192369926-192369948 ACATCGGAGAAAATTCATTAAGG No data
943824319_943824324 19 Left 943824319 2:192369884-192369906 CCCCTAGGGGAGTGGGGTGAGGG No data
Right 943824324 2:192369926-192369948 ACATCGGAGAAAATTCATTAAGG No data
943824314_943824324 29 Left 943824314 2:192369874-192369896 CCAGGATTCTCCCCTAGGGGAGT No data
Right 943824324 2:192369926-192369948 ACATCGGAGAAAATTCATTAAGG No data
943824321_943824324 18 Left 943824321 2:192369885-192369907 CCCTAGGGGAGTGGGGTGAGGGT No data
Right 943824324 2:192369926-192369948 ACATCGGAGAAAATTCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943824324 Original CRISPR ACATCGGAGAAAATTCATTA AGG Intergenic
No off target data available for this crispr