ID: 943833195

View in Genome Browser
Species Human (GRCh38)
Location 2:192487830-192487852
Sequence GGTCCAGGGAACCGGAGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943833195_943833202 28 Left 943833195 2:192487830-192487852 CCGATGCTCCGGTTCCCTGGACC No data
Right 943833202 2:192487881-192487903 TCTAACTCTTTTGTCTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943833195 Original CRISPR GGTCCAGGGAACCGGAGCAT CGG (reversed) Intergenic
No off target data available for this crispr