ID: 943833208

View in Genome Browser
Species Human (GRCh38)
Location 2:192487900-192487922
Sequence CCCAGCGGGTACCCCGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943833208_943833215 -9 Left 943833208 2:192487900-192487922 CCGGACTCGGGGTACCCGCTGGG No data
Right 943833215 2:192487914-192487936 CCCGCTGGGTGGTGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943833208 Original CRISPR CCCAGCGGGTACCCCGAGTC CGG (reversed) Intergenic
No off target data available for this crispr