ID: 943843083

View in Genome Browser
Species Human (GRCh38)
Location 2:192604373-192604395
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943843079_943843083 15 Left 943843079 2:192604335-192604357 CCTTGGCAGTATCAGTGGTGGGA No data
Right 943843083 2:192604373-192604395 CAAGTAGTGCCCATTGATATAGG No data
943843075_943843083 30 Left 943843075 2:192604320-192604342 CCAGTGTGGTATGAGCCTTGGCA No data
Right 943843083 2:192604373-192604395 CAAGTAGTGCCCATTGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr