ID: 943843699

View in Genome Browser
Species Human (GRCh38)
Location 2:192613336-192613358
Sequence GTGTGCTTACTGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943843695_943843699 10 Left 943843695 2:192613303-192613325 CCTGCATGCATGCCATTTTATTA No data
Right 943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG No data
943843694_943843699 14 Left 943843694 2:192613299-192613321 CCAACCTGCATGCATGCCATTTT No data
Right 943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG No data
943843693_943843699 30 Left 943843693 2:192613283-192613305 CCTGCTGTTGGTGCATCCAACCT No data
Right 943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG No data
943843696_943843699 -2 Left 943843696 2:192613315-192613337 CCATTTTATTACTCTTTGTAAGT No data
Right 943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943843699 Original CRISPR GTGTGCTTACTGAGGGAAGC TGG Intergenic
No off target data available for this crispr