ID: 943844982

View in Genome Browser
Species Human (GRCh38)
Location 2:192634470-192634492
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943844974_943844982 26 Left 943844974 2:192634421-192634443 CCTCCAGCAGTGGCCATATGGTG No data
Right 943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG No data
943844972_943844982 30 Left 943844972 2:192634417-192634439 CCATCCTCCAGCAGTGGCCATAT No data
Right 943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG No data
943844976_943844982 13 Left 943844976 2:192634434-192634456 CCATATGGTGATGAGAGAGAATT No data
Right 943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG No data
943844975_943844982 23 Left 943844975 2:192634424-192634446 CCAGCAGTGGCCATATGGTGATG No data
Right 943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type