ID: 943849700

View in Genome Browser
Species Human (GRCh38)
Location 2:192702514-192702536
Sequence ACATATCCGTGTAGATAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943849700_943849702 -6 Left 943849700 2:192702514-192702536 CCCTCTTATCTACACGGATATGT No data
Right 943849702 2:192702531-192702553 ATATGTTTAAAGACTGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943849700 Original CRISPR ACATATCCGTGTAGATAAGA GGG (reversed) Intergenic
No off target data available for this crispr