ID: 943861148

View in Genome Browser
Species Human (GRCh38)
Location 2:192864066-192864088
Sequence AGATTTCTGCAGCAGATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943861148_943861149 -8 Left 943861148 2:192864066-192864088 CCTGGCATCTGCTGCAGAAATCT No data
Right 943861149 2:192864081-192864103 AGAAATCTCTGCCCAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943861148 Original CRISPR AGATTTCTGCAGCAGATGCC AGG (reversed) Intergenic
No off target data available for this crispr