ID: 943876200

View in Genome Browser
Species Human (GRCh38)
Location 2:193071142-193071164
Sequence ACTAGGCAGTGCCCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943876200_943876208 -6 Left 943876200 2:193071142-193071164 CCCCCACTGGGGCACTGCCTAGT No data
Right 943876208 2:193071159-193071181 CCTAGTGGAGCTGTGAGAAGGGG No data
943876200_943876209 -5 Left 943876200 2:193071142-193071164 CCCCCACTGGGGCACTGCCTAGT No data
Right 943876209 2:193071160-193071182 CTAGTGGAGCTGTGAGAAGGGGG No data
943876200_943876206 -7 Left 943876200 2:193071142-193071164 CCCCCACTGGGGCACTGCCTAGT No data
Right 943876206 2:193071158-193071180 GCCTAGTGGAGCTGTGAGAAGGG No data
943876200_943876205 -8 Left 943876200 2:193071142-193071164 CCCCCACTGGGGCACTGCCTAGT No data
Right 943876205 2:193071157-193071179 TGCCTAGTGGAGCTGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943876200 Original CRISPR ACTAGGCAGTGCCCCAGTGG GGG (reversed) Intergenic