ID: 943876401

View in Genome Browser
Species Human (GRCh38)
Location 2:193072713-193072735
Sequence TGTCGACAACACAAAATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943876401_943876405 0 Left 943876401 2:193072713-193072735 CCAAGCATTTTGTGTTGTCGACA No data
Right 943876405 2:193072736-193072758 GTGGTTGCAATGGGCTAGTCAGG No data
943876401_943876411 30 Left 943876401 2:193072713-193072735 CCAAGCATTTTGTGTTGTCGACA No data
Right 943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG No data
943876401_943876408 23 Left 943876401 2:193072713-193072735 CCAAGCATTTTGTGTTGTCGACA No data
Right 943876408 2:193072759-193072781 TCAGCCTCCAGGCCCACAGGTGG No data
943876401_943876404 -9 Left 943876401 2:193072713-193072735 CCAAGCATTTTGTGTTGTCGACA No data
Right 943876404 2:193072727-193072749 TTGTCGACAGTGGTTGCAATGGG No data
943876401_943876407 20 Left 943876401 2:193072713-193072735 CCAAGCATTTTGTGTTGTCGACA No data
Right 943876407 2:193072756-193072778 AGGTCAGCCTCCAGGCCCACAGG No data
943876401_943876406 12 Left 943876401 2:193072713-193072735 CCAAGCATTTTGTGTTGTCGACA No data
Right 943876406 2:193072748-193072770 GGCTAGTCAGGTCAGCCTCCAGG No data
943876401_943876403 -10 Left 943876401 2:193072713-193072735 CCAAGCATTTTGTGTTGTCGACA No data
Right 943876403 2:193072726-193072748 GTTGTCGACAGTGGTTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943876401 Original CRISPR TGTCGACAACACAAAATGCT TGG (reversed) Intergenic
No off target data available for this crispr