ID: 943876411

View in Genome Browser
Species Human (GRCh38)
Location 2:193072766-193072788
Sequence CCAGGCCCACAGGTGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943876401_943876411 30 Left 943876401 2:193072713-193072735 CCAAGCATTTTGTGTTGTCGACA No data
Right 943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943876411 Original CRISPR CCAGGCCCACAGGTGGTGCT TGG Intergenic
No off target data available for this crispr