ID: 943878265

View in Genome Browser
Species Human (GRCh38)
Location 2:193102267-193102289
Sequence GAGGCTAGGTCTGGGAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943878256_943878265 12 Left 943878256 2:193102232-193102254 CCTTTTTGGAGGCTGGGCAGGCA No data
Right 943878265 2:193102267-193102289 GAGGCTAGGTCTGGGAGGAGTGG No data
943878250_943878265 29 Left 943878250 2:193102215-193102237 CCATGGATCTATCAGGGCCTTTT No data
Right 943878265 2:193102267-193102289 GAGGCTAGGTCTGGGAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943878265 Original CRISPR GAGGCTAGGTCTGGGAGGAG TGG Intergenic
No off target data available for this crispr