ID: 943888653

View in Genome Browser
Species Human (GRCh38)
Location 2:193256516-193256538
Sequence GAAAATGCACAGATATTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943888647_943888653 13 Left 943888647 2:193256480-193256502 CCCCTAGACAAAGACAGTAGCAG 0: 1
1: 0
2: 1
3: 8
4: 133
Right 943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG 0: 1
1: 0
2: 3
3: 22
4: 310
943888648_943888653 12 Left 943888648 2:193256481-193256503 CCCTAGACAAAGACAGTAGCAGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG 0: 1
1: 0
2: 3
3: 22
4: 310
943888650_943888653 -10 Left 943888650 2:193256503-193256525 CCCCAGATCTACAGAAAATGCAC 0: 1
1: 0
2: 1
3: 59
4: 1531
Right 943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG 0: 1
1: 0
2: 3
3: 22
4: 310
943888649_943888653 11 Left 943888649 2:193256482-193256504 CCTAGACAAAGACAGTAGCAGCC 0: 1
1: 0
2: 4
3: 21
4: 184
Right 943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG 0: 1
1: 0
2: 3
3: 22
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943888653 Original CRISPR GAAAATGCACAGATATTGTT AGG Intergenic
901109407 1:6783950-6783972 GAAAAAGAACACATGTTGTTAGG + Intergenic
901324804 1:8359991-8360013 GAAAAGCCACAGATCTTGCTGGG + Intronic
901488829 1:9585480-9585502 TGAAATGCACAGTTAATGTTGGG + Intergenic
902235132 1:15052518-15052540 GTATATGCACTGATATGGTTTGG - Intronic
903329059 1:22587863-22587885 GAAAATGCACAGATCTGGGCAGG - Intronic
906046088 1:42832001-42832023 GCAAATGCAAAGACATGGTTTGG - Intronic
907656067 1:56342892-56342914 GAGAATTTAGAGATATTGTTTGG + Intergenic
907934940 1:59033572-59033594 GAAAGGCAACAGATATTGTTGGG - Intergenic
908677129 1:66617813-66617835 AAAAATGGAGAGATATTTTTAGG - Intronic
908905213 1:69000547-69000569 GAATGTGCACTGATATGGTTTGG - Intergenic
909273468 1:73654510-73654532 GAACATGCACTGATATGGTTTGG + Intergenic
909637327 1:77831148-77831170 GAAAGTAAACAGATCTTGTTTGG + Intronic
910526215 1:88181546-88181568 GATAGTGCACAGATGTTGCTCGG - Intergenic
911370017 1:96985560-96985582 GAAAATGAACTAATATAGTTAGG - Intergenic
911373746 1:97025072-97025094 GAAAAGGCACAGACATGGCTGGG + Intergenic
911653890 1:100421106-100421128 GCATTTGCACAGATAATGTTTGG - Intronic
911659018 1:100478869-100478891 GAAAATGCCTAGGAATTGTTGGG + Intronic
914951935 1:152123703-152123725 GAAAATCCAGAGATATTCTGAGG + Intergenic
916608233 1:166363890-166363912 GAAAAAGGACAGTTATTGTGAGG - Intergenic
916875863 1:168967971-168967993 ATAAATGCACATATCTTGTTGGG - Intergenic
916955166 1:169824968-169824990 CAAAAGGAACAGATTTTGTTGGG - Intronic
919394663 1:197030186-197030208 GAGAATGCAGAGATTTTGTAGGG + Intergenic
919824409 1:201493302-201493324 GAAAGGGCACTGATATGGTTTGG + Intronic
921295221 1:213694964-213694986 GTAGAGGCACAGAGATTGTTGGG + Intergenic
921522858 1:216177920-216177942 GAAAGTCCACAGATGTAGTTTGG - Intronic
922194140 1:223345314-223345336 GAATATTCACAGAGATTGGTGGG - Intronic
922450578 1:225734090-225734112 GAAAAGCCACAGATGTTGTTTGG - Intergenic
922626485 1:227050467-227050489 GCAAATGTACAGAGTTTGTTTGG - Intronic
923035222 1:230280784-230280806 GTAAATGAGCAGGTATTGTTTGG - Exonic
923904061 1:238363018-238363040 GAATATCCTCAGATATTATTTGG + Intergenic
1063115866 10:3071143-3071165 AAAATTACACAGATATTCTTTGG + Intronic
1063182852 10:3621669-3621691 TAAATTGCACAGATATTCGTGGG - Intergenic
1063531323 10:6833898-6833920 GAAAAAGTACACATTTTGTTTGG - Intergenic
1065635319 10:27727170-27727192 GAAACTGTACAGATATTTTAGGG - Intronic
1065636068 10:27735866-27735888 GAAATTCCACAGAAATTGTAGGG + Intronic
1066038708 10:31522521-31522543 GAAAATGCATATGTATTTTTAGG - Intronic
1066046091 10:31596804-31596826 GAGAATACCCAGATATTTTTAGG + Intergenic
1066090933 10:32019306-32019328 GCAAATCAACTGATATTGTTAGG - Intronic
1066808604 10:39293215-39293237 GAATCTGCACAGATATAGCTGGG - Intergenic
1067471106 10:46538729-46538751 GAAATTGTACAGAGATAGTTTGG + Intergenic
1071361230 10:84848072-84848094 GGAAAAGCACAGATATTGCTCGG + Intergenic
1072631261 10:97148203-97148225 GAAAATGCACATAAAGTTTTTGG + Intronic
1073549486 10:104384664-104384686 GAAAATGCAGAGAAAAGGTTTGG + Intronic
1073719765 10:106154727-106154749 CACAATGCACAGATGTTCTTTGG - Intergenic
1075111530 10:119589858-119589880 TAAATTTTACAGATATTGTTTGG - Intronic
1077204115 11:1333506-1333528 GAATATACACAGAGACTGTTAGG + Intergenic
1079312208 11:19377102-19377124 GAAAAAGGACAGAGATTGCTGGG - Intronic
1079648078 11:22892217-22892239 GAAAATGGAAAAATATGGTTAGG + Intergenic
1080518411 11:33044630-33044652 GAAAAAGTACAGACATTTTTGGG + Intronic
1082585745 11:54937420-54937442 GAAACTGCACAGTTATATTTGGG - Intergenic
1082898595 11:58220479-58220501 TAAAATGCACAGATCTTCATTGG - Intergenic
1085577286 11:77617550-77617572 AAAAATGTACAGACATTGTTCGG + Intronic
1086188729 11:84052138-84052160 GAAAATGCACATATATGTTTGGG - Intronic
1086663252 11:89448138-89448160 GAAAATGAATAGAAATTTTTAGG - Intronic
1087462270 11:98460388-98460410 GAAAATGCTAAAATATTTTTAGG + Intergenic
1087826767 11:102773469-102773491 GTAAATGCAGAGAGATTGATGGG - Intronic
1087990188 11:104739938-104739960 TAAAATTGATAGATATTGTTTGG + Intergenic
1089148090 11:116344937-116344959 GAAAATAAACAGATAGTGTCAGG + Intergenic
1090187098 11:124745956-124745978 GAAAATGCTCAGTTCTTCTTCGG - Exonic
1090297699 11:125603810-125603832 AATGATGTACAGATATTGTTAGG + Intronic
1090619154 11:128546125-128546147 GAAAATGCTAAGACATTGCTGGG + Intronic
1091261511 11:134238284-134238306 GAAAATGCAGAGACATGTTTAGG + Intronic
1092326807 12:7541259-7541281 GAAAATGTACATATTTAGTTAGG - Intergenic
1092389170 12:8060240-8060262 GAAAATGCATACATATTCTTAGG + Intronic
1093413808 12:18896690-18896712 TACAATGAACACATATTGTTTGG + Intergenic
1093487830 12:19671190-19671212 TAAAATGAACAGATATTTATCGG + Intronic
1096766526 12:53895267-53895289 AAAAATGAACAGATAATATTGGG - Intergenic
1096856300 12:54486535-54486557 GAAAGTGACCAGATATTGGTAGG + Intergenic
1097900650 12:64870414-64870436 GAAAATGCAGAAATATTTTCAGG + Intronic
1097965393 12:65573759-65573781 GAAAATAAAGAGATATTATTGGG + Intergenic
1099023835 12:77441022-77441044 TAAAATGCATACATATTCTTAGG + Intergenic
1099383068 12:81979394-81979416 GGTAATGAAGAGATATTGTTGGG + Intergenic
1099779929 12:87181933-87181955 TATAATACACAGATATGGTTTGG + Intergenic
1100080501 12:90843242-90843264 GAAAATGCACATATTGTATTTGG + Intergenic
1101023800 12:100580521-100580543 AAAAATGCCCAGAAAATGTTTGG - Intronic
1102541710 12:113624552-113624574 GAATATCCACATAAATTGTTTGG + Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1105976379 13:25477190-25477212 GAAATGGCACAGATTTTTTTTGG - Intronic
1106428956 13:29661067-29661089 GAAATTGCTCAGAAAGTGTTGGG + Intergenic
1108757554 13:53522266-53522288 GAAAGGGCACAGGTATTGCTAGG + Intergenic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109880218 13:68463611-68463633 GAAAATGTATTGATATGGTTTGG + Intergenic
1110162150 13:72391153-72391175 GATAATGAACAGATATTATGTGG + Intergenic
1110393191 13:74999843-74999865 GACAATGCACAGAAAGTGTCTGG + Intergenic
1110960748 13:81621833-81621855 AAAAAAGCAGAGATATTGTATGG + Intergenic
1111015899 13:82381653-82381675 TAAAATGCTCTGATATGGTTTGG + Intergenic
1111294403 13:86260212-86260234 GAAAATGAACAAATATTATGGGG - Intergenic
1111299285 13:86325634-86325656 GTCAATGCACAGAAATTGCTAGG + Intergenic
1111548343 13:89774316-89774338 TAAAATATACACATATTGTTGGG - Intergenic
1112566400 13:100554454-100554476 GTAAATGTACAGACCTTGTTTGG + Intronic
1114308294 14:21442867-21442889 ACAACTGCACAAATATTGTTGGG + Intronic
1114572273 14:23680200-23680222 GAAAATACACAAATAATGTCTGG + Intergenic
1115425807 14:33257774-33257796 AAAAAGGCACAGTTATTCTTGGG - Intronic
1115546277 14:34467378-34467400 GAAAATGCACAGTTTTTAGTTGG + Intergenic
1116121112 14:40723164-40723186 GTGAATGCAGAGATTTTGTTGGG + Intergenic
1116516409 14:45811920-45811942 GCAAATGCACAGAAATTGAGAGG - Intergenic
1117696352 14:58368391-58368413 GAAAATGCACATGTAGTGATTGG - Intronic
1118023505 14:61744091-61744113 AACAATGCAGTGATATTGTTGGG - Intronic
1119042429 14:71287078-71287100 GAGAATGCAGAGATGTTGATAGG - Intergenic
1119532620 14:75373645-75373667 GAAAATGAACAGAAATTGCTAGG - Intergenic
1120548691 14:85843078-85843100 GAATATGCACAGGCATTGTGGGG - Intergenic
1121041035 14:90747732-90747754 GCAAATGCACAGTTATGCTTGGG - Intronic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1121368555 14:93336811-93336833 CAAAATGTACTGATATGGTTTGG + Intronic
1121846650 14:97177942-97177964 GAAAAGCCACTGATATGGTTTGG - Intergenic
1125316057 15:38432651-38432673 GAATAAGCACAGATCTGGTTTGG + Intergenic
1127009721 15:54610084-54610106 CAATATGCACTGATATGGTTTGG - Intronic
1127523222 15:59764469-59764491 GAAAATGCACAAAGAATGATGGG - Intergenic
1127567644 15:60208337-60208359 TGAAATGCTCAAATATTGTTTGG - Intergenic
1128354333 15:66914137-66914159 AAAAATACACAGTTATTATTAGG - Intergenic
1130764080 15:86852426-86852448 GGAAATGGACTGATATGGTTTGG - Intronic
1131439671 15:92449614-92449636 GAGAATGCTTATATATTGTTGGG - Intronic
1135124342 16:19795526-19795548 GAAAATGAACAAATATTATGGGG + Intronic
1137451074 16:48574792-48574814 GAATATGTTCAGACATTGTTTGG + Intronic
1137609814 16:49810795-49810817 GTAAATGCACAGAAAGTGTCCGG - Intronic
1137836702 16:51598851-51598873 GACAATGGACATATGTTGTTGGG + Intergenic
1139109362 16:63870182-63870204 GAAAATTCAGTCATATTGTTAGG + Intergenic
1140587239 16:76307996-76308018 GAAAATGCATAGAAATTTATAGG + Intronic
1143988768 17:10938828-10938850 GAAAATGCACAGGTACTGGAGGG + Intergenic
1144417454 17:15064610-15064632 GAAAATGAAAAGATGTTTTTTGG + Intergenic
1149355858 17:55838700-55838722 GATAATGCACATAAATTGCTTGG - Intronic
1149799308 17:59552009-59552031 GAAAATGCAAAGCTATTCTGTGG - Intergenic
1150123241 17:62620275-62620297 GAAAAAGCATATTTATTGTTTGG + Intergenic
1153245629 18:3070590-3070612 GAAAATGCACAGTACTTGTTGGG + Intronic
1153246201 18:3074727-3074749 GAAAATGTACAGTATTTGTTGGG + Intronic
1153577261 18:6535149-6535171 AAAAATACACAGAAATTATTTGG - Intronic
1153639294 18:7141630-7141652 GCAAATCTACAAATATTGTTGGG - Intergenic
1154234300 18:12589505-12589527 GAAAAGGCACAAATATTGCCAGG + Intronic
1154239258 18:12637522-12637544 GTAAATACACTGATATTGCTGGG + Intronic
1154296222 18:13151752-13151774 GAAGATGCACAGTTATACTTCGG - Intergenic
1155583148 18:27335028-27335050 CAAAATGCACAGAAATTGCAAGG - Intergenic
1155776823 18:29774916-29774938 GAAATTGGAGAGATATTGATTGG - Intergenic
1158152778 18:54391135-54391157 GAAAATGCACTGGTTTTGTAAGG - Intergenic
1159530561 18:69650475-69650497 GGAAATGCCTAGATATTGCTTGG + Intronic
1159830492 18:73272573-73272595 GAAGAGGCGCCGATATTGTTTGG - Intergenic
1161229993 19:3169512-3169534 GCAAATACAAAGATATTATTAGG - Intergenic
1161908182 19:7173186-7173208 GTAAATCGACAGATATTGTAAGG - Intronic
1165971274 19:39632762-39632784 GGAAATGCAAGGATATTTTTTGG - Intergenic
1166274607 19:41744133-41744155 GAAAAGGCACAGGCATTGGTAGG + Intronic
1168593826 19:57657935-57657957 GAACATGCACAGACCTTTTTTGG - Intergenic
927283394 2:21331515-21331537 GAAAATACACAGATAAAGTCTGG - Intergenic
928836392 2:35551795-35551817 GTAAATGGACTGATATGGTTTGG - Intergenic
930413567 2:51059120-51059142 GAGAAAGCAGAGAAATTGTTTGG + Intergenic
931051439 2:58419273-58419295 GCAAAAGCAAAGATATTTTTAGG - Intergenic
933947363 2:87298119-87298141 GAGAGTGCACTGATATGGTTTGG - Intergenic
935279593 2:101505985-101506007 AAAAAGGCACAGAGATGGTTGGG + Intergenic
935514123 2:104013520-104013542 AAAAAGGCACTGATATGGTTTGG - Intergenic
936339310 2:111617361-111617383 GCAAATGCACAGAGAATGTAAGG - Intergenic
938834922 2:135091988-135092010 GAAAAAGCACAGATTTTTTCAGG - Intronic
940261732 2:151787726-151787748 GAAAACACACAGAGATTGATTGG - Intergenic
940720016 2:157271768-157271790 GAAGATGTTCAGAAATTGTTTGG + Intronic
942608938 2:177721600-177721622 CATAAAGCACAAATATTGTTAGG - Intronic
943151046 2:184113493-184113515 GAAAATGAATAGACATTGTTTGG - Intergenic
943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG + Intergenic
944068050 2:195639885-195639907 GAAAATCCACATAAATTATTTGG + Intronic
944112401 2:196147088-196147110 TAAAATCCACAGATTTTTTTAGG + Intronic
944433024 2:199657073-199657095 TAAAATGCCCAGATTTTGTTTGG + Intergenic
944914608 2:204345484-204345506 GAATATGTACAGAAATTATTTGG - Intergenic
945168617 2:206972460-206972482 GAAAAAGCACTGATAGAGTTTGG - Intergenic
945443040 2:209903161-209903183 TAAAATGCACAGACATTTTTGGG - Intronic
947013228 2:225589344-225589366 GAGAATCCACACATTTTGTTTGG + Intronic
947952106 2:234157094-234157116 AAAGATGCACAGAAACTGTTTGG - Intergenic
948447922 2:238047624-238047646 GAAAAGCCATAGATATTGTTGGG - Intronic
1170361368 20:15549815-15549837 GAAAATGCACAGACAATATTTGG - Intronic
1170424538 20:16225837-16225859 GAAAAAGCACAGAATTTGTATGG - Intergenic
1172336915 20:34124226-34124248 GAAAATTCATAGATATGGCTGGG - Intergenic
1177006387 21:15677388-15677410 GTAAATGCAGAGAAAATGTTTGG - Intergenic
1177007455 21:15691137-15691159 GGAAATAAAAAGATATTGTTGGG + Intergenic
1178107835 21:29340062-29340084 GAAAATGGAAATATATTGTAGGG + Intronic
1178706819 21:34882441-34882463 GAAAAGGCCCAGACCTTGTTTGG - Intronic
1179288801 21:40000591-40000613 GCAAATGCAGTGATATGGTTTGG + Intergenic
1179309174 21:40181734-40181756 GACAATGCACAGAAATCGTTTGG + Intronic
1180019968 21:45116879-45116901 AAAAAGACACAGATATTGTTTGG - Intronic
1183155560 22:36072316-36072338 AAAAAAGCACAGAGATTGATTGG - Intergenic
1184061289 22:42083531-42083553 GAAAATGCACAGTTTCTGTTGGG - Exonic
1184508303 22:44917329-44917351 GAAAATGCACAGGAAGTGCTGGG + Intronic
949510873 3:4765634-4765656 GAAGAAGCAAATATATTGTTGGG + Intronic
949611938 3:5711682-5711704 GAAAAAGTACTGATATGGTTTGG - Intergenic
954493794 3:50933214-50933236 GAAAAGGTACTGATATGGTTTGG - Intronic
955062145 3:55502336-55502358 GCTAATGCACAGACATTGTGGGG + Intergenic
956386243 3:68722934-68722956 GAAAATGAACAGATATTCACAGG - Intergenic
956609725 3:71110407-71110429 GAAAATGAAAATATATTATTGGG - Intronic
956859855 3:73311922-73311944 GAGAACACACAGACATTGTTGGG - Intergenic
957115313 3:76016720-76016742 TAAAATGCCAAGATATTGGTGGG + Intronic
957289993 3:78267847-78267869 AAAGATGTACAGATATTGTTGGG + Intergenic
957595251 3:82256491-82256513 TATAATGAACAGATAATGTTAGG - Intergenic
957823460 3:85409469-85409491 AAAAATGCAGAGATATGGTCAGG + Intronic
959155178 3:102658415-102658437 CAAAAGGCACTGATATGGTTTGG - Intergenic
959441405 3:106379821-106379843 CAAAATGCATTGAAATTGTTTGG - Intergenic
960778933 3:121295579-121295601 GAAAATTCACACATACTGCTAGG - Intronic
961900683 3:130208309-130208331 GAAAATTATCATATATTGTTGGG + Intergenic
962853155 3:139323080-139323102 GAAAAAGCTCAGAGTTTGTTTGG + Intronic
963283401 3:143409314-143409336 GATAATGCACAGACATTTTCAGG + Intronic
963834973 3:150048931-150048953 GAAAATGAAAAGAAATTGTGTGG + Intronic
964856617 3:161152442-161152464 AAAAAGGCACTGATATGGTTTGG - Intronic
965011956 3:163105753-163105775 GAAAACCCACACATATTGTACGG + Intergenic
966006492 3:175020083-175020105 GGAAATCCACAGATTCTGTTGGG + Intronic
968333265 3:197890097-197890119 AAAAATGCACAGATAATGCCAGG + Intronic
968345247 3:197998905-197998927 GCAAATGCACAGATAATTTGGGG - Intronic
969001232 4:3983945-3983967 AAAAATGGACAGCCATTGTTGGG - Intergenic
970706429 4:18809232-18809254 ACAAATACACTGATATTGTTTGG - Intergenic
971559599 4:28060264-28060286 GAAAATGCTGACATAATGTTGGG - Intergenic
971796207 4:31231965-31231987 CTAACTGCACAGACATTGTTTGG - Intergenic
973687155 4:53382758-53382780 TAAAATGCACAAATATTCATAGG - Intronic
975960833 4:79902507-79902529 AAAGAAGCACAGAGATTGTTAGG - Intronic
975993387 4:80284659-80284681 GGAAATGCTCTGATATTGGTTGG + Intronic
977369711 4:96120193-96120215 GAATTTGCACACATATTTTTAGG - Intergenic
979410515 4:120373019-120373041 GAAAATGAACAAATATAGTTGGG - Intergenic
979412735 4:120398580-120398602 AAAAATCCACAGAAATTTTTTGG + Intergenic
979544743 4:121926916-121926938 GAAAACACACAGAGATTGCTGGG - Intronic
979593175 4:122504271-122504293 GAAAGTGGGCATATATTGTTGGG - Intergenic
979891708 4:126105239-126105261 TAAAATACACACATATCGTTTGG + Intergenic
979962070 4:127033102-127033124 GATAATGAACAGATATTTATTGG - Intergenic
981086989 4:140694140-140694162 GAATGTGCAAAGATTTTGTTGGG + Intronic
981695401 4:147554087-147554109 AAAAAGGCACTGATATAGTTTGG - Intergenic
982767344 4:159364265-159364287 GAAGATGCAGAGAAATTGGTTGG + Intergenic
982974183 4:162032458-162032480 GAAAATGCACAGAAATAGTTTGG + Intronic
983838447 4:172423289-172423311 AGAAATGCAGAGACATTGTTGGG - Intronic
984073876 4:175150879-175150901 GATAAACCCCAGATATTGTTTGG - Intergenic
984792198 4:183625202-183625224 GAACATGTACAGACATTTTTTGG - Intergenic
985264589 4:188146084-188146106 GATAATGTACAGAAAATGTTTGG + Intronic
986951559 5:13092652-13092674 GTAAATGCACAGATTTTGTGGGG - Intergenic
987512120 5:18853480-18853502 AAAAATACACACATATGGTTTGG + Intergenic
987645221 5:20662493-20662515 GAAACTGGATAGATATTTTTTGG - Intergenic
988152409 5:27401890-27401912 GAAAATACACTGAAAATGTTGGG + Intergenic
988209837 5:28188860-28188882 GATAATGCACATATAATTTTAGG + Intergenic
988495703 5:31743864-31743886 CAAAATGCACAGTCATTGTCTGG - Intronic
988828079 5:34960364-34960386 CAAAATGCAGAGGTAATGTTTGG + Intergenic
989121651 5:38010303-38010325 GAAAGAGAACAGACATTGTTGGG - Intergenic
992283300 5:75204848-75204870 GAAAATGCACAGATATTAACAGG + Intronic
992348607 5:75906611-75906633 GAAATTTAACAGATATTATTAGG + Intergenic
993429038 5:87808367-87808389 AAAAATGCTGAGATCTTGTTTGG - Intergenic
994756791 5:103803101-103803123 AAAAAAGTACAGATATTATTTGG - Intergenic
994955245 5:106522355-106522377 GAACATGCAAAGATTTTATTTGG - Intergenic
994994978 5:107049528-107049550 AAAAATACACTGATATGGTTTGG + Intergenic
996401381 5:123066865-123066887 GAAAAAGATGAGATATTGTTTGG - Intergenic
996945820 5:129066351-129066373 GTAAATGCACACAATTTGTTAGG - Intergenic
998183784 5:139963592-139963614 GAAAATGCATATAAAGTGTTTGG - Intronic
999026433 5:148237075-148237097 GAAAACCCACTGATATGGTTTGG - Intergenic
1000189830 5:158899747-158899769 GAAAATGAAGAGATATTGAATGG + Intronic
1001304550 5:170562206-170562228 GCAAATGCACATTTATTCTTTGG - Intronic
1001713408 5:173795524-173795546 AAAAAGACACAGAAATTGTTAGG + Intergenic
1004907688 6:20251962-20251984 GAAACTGCACAGATAGTCTAGGG - Intergenic
1005146697 6:22699731-22699753 CAGAATGCACAGACATTTTTTGG + Intergenic
1006236313 6:32636535-32636557 GAAAAGGCAAAGGTATTGCTTGG + Intronic
1006246401 6:32740851-32740873 GAAAAGGCAAAGGTATTGCTTGG + Intergenic
1006540401 6:34735344-34735366 GAAAATGCTCAAAGAATGTTGGG - Intergenic
1009380108 6:63017129-63017151 GTAATTGCATTGATATTGTTTGG + Intergenic
1010128370 6:72462046-72462068 GAAAGTGAAGAGAAATTGTTAGG + Intergenic
1010143379 6:72637735-72637757 GAAAAGGCAGAGAAATTGATTGG + Intronic
1010858387 6:80872487-80872509 GAAAATTCACAGCTCTTGCTGGG + Intergenic
1012198551 6:96376370-96376392 TAAAATGTACAAATATTCTTAGG - Intergenic
1012261931 6:97097476-97097498 GATATTGCACGGATATAGTTTGG + Intronic
1012287327 6:97407705-97407727 GATAATGAACAGACAATGTTAGG - Intergenic
1012919347 6:105205490-105205512 AAAAATGCAGATATACTGTTTGG - Intergenic
1014875280 6:126650903-126650925 GAAAATGCAAATATATTCTCAGG - Intergenic
1014960181 6:127673474-127673496 GAAACTGCACCAATATTGCTGGG + Intergenic
1015951264 6:138555167-138555189 GAAAAGGCTCAGATCATGTTCGG - Intronic
1016421500 6:143889094-143889116 GAAAATGGACATATATTGTAAGG + Intronic
1016622163 6:146123503-146123525 GAAAACGTACAGATGTTTTTGGG - Intronic
1020836735 7:13162507-13162529 GAATATTCACAAATATTATTTGG - Intergenic
1022981292 7:35607078-35607100 GAAAGTGCCCTGATAGTGTTGGG - Intergenic
1023645157 7:42304251-42304273 GTCAATACACAGATATGGTTGGG - Intergenic
1027865104 7:83636344-83636366 GAAAATGAAATGATAGTGTTGGG - Intronic
1027942616 7:84703932-84703954 TAAAATGCATTAATATTGTTAGG + Intergenic
1028348825 7:89818306-89818328 GAAAGTGCACAGAAAATGATTGG - Intergenic
1028813176 7:95112438-95112460 GAAAATGGTTAGATACTGTTGGG + Intronic
1029292034 7:99509417-99509439 GAAATTTCACAGATATGGTCAGG - Intronic
1029619831 7:101683296-101683318 GAGGATGCACAGAAATTGCTGGG - Intergenic
1029902200 7:104053398-104053420 GAAAGTGCACACTTATTGATGGG + Intergenic
1030266076 7:107623379-107623401 TGAAATGCACAGCTATTGTGGGG - Intronic
1030484852 7:110152343-110152365 GAAAATGCCTAGCTAATGTTAGG - Intergenic
1030534941 7:110754545-110754567 GAAAATGAAAAGTTATTTTTGGG + Intronic
1030644574 7:112045672-112045694 GAATATCCTCAGATATTATTGGG - Intronic
1030909701 7:115231592-115231614 AGAAATGCACAGACATTGTAGGG + Intergenic
1031081714 7:117264785-117264807 GGAAATGCACACAGATTGTGTGG - Intergenic
1031950458 7:127886364-127886386 AAACATGCACAGATACTGGTTGG + Intronic
1031951776 7:127900130-127900152 GAAAATTCACAGATACTTTAGGG + Intronic
1031960687 7:127986867-127986889 GAAAATGCTCAGGAATTTTTGGG + Intronic
1032053729 7:128667777-128667799 GAACATGCACAGACAATTTTGGG - Intergenic
1033710964 7:143943496-143943518 ATAAATGCACAGATATTTTCAGG + Intergenic
1033779876 7:144656113-144656135 AAAAATGCACAAATATATTTAGG - Intronic
1037009920 8:13828845-13828867 GAAAATGCAAAGATAGCCTTTGG - Intergenic
1037137609 8:15481514-15481536 GAAAATGAACAGAAATTTATTGG - Intronic
1037290970 8:17349091-17349113 GAAAATACAAAGAGATTTTTAGG + Intronic
1038063169 8:23934797-23934819 AAAAACGCAGAAATATTGTTCGG - Intergenic
1038457173 8:27683405-27683427 AAAAAGGCACACATATTATTGGG - Intergenic
1039251956 8:35675852-35675874 GAAAATTCTCACATATTGTCTGG + Intronic
1039305951 8:36263273-36263295 GTAAATGCTCTGATATGGTTTGG + Intergenic
1040589466 8:48777203-48777225 GAAAATGCACATTTAGTTTTGGG + Intergenic
1042610497 8:70594703-70594725 AAAGGTGCACAGATATTGTATGG - Intronic
1043106675 8:76122309-76122331 CAAAATGCAATCATATTGTTGGG + Intergenic
1043991766 8:86764368-86764390 GAAAATTCACATATAGAGTTAGG - Intergenic
1045296099 8:100872825-100872847 GAATATGAACAGATATGGGTTGG + Intergenic
1045396103 8:101762139-101762161 GAAAATGCATATATATTAGTCGG - Intronic
1045507280 8:102787756-102787778 GATAATGCACATATATTGGCTGG - Intergenic
1046373944 8:113350734-113350756 GAAAATGCACAAAGAATATTAGG - Intronic
1046430083 8:114113402-114113424 GAAACTTCACGGATATGGTTTGG + Intergenic
1047653296 8:126947919-126947941 GAAAATGCTCAGATGTTCTTTGG + Intergenic
1049141088 8:140955154-140955176 CAAAAGACACAGATATGGTTTGG + Intronic
1050500424 9:6292751-6292773 GAAAATGCACAGGGACTTTTAGG - Intergenic
1052381454 9:27775365-27775387 GAAAAAGCAAAGATGCTGTTTGG - Intergenic
1052503868 9:29327894-29327916 GATAATGTATAGATCTTGTTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054793053 9:69273718-69273740 GAAAATGCAAAAATATCCTTTGG - Intergenic
1055370747 9:75596092-75596114 GTAAATGCAGATATATAGTTAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056608301 9:88106002-88106024 TAAAATGCAGAGATACTGATGGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056904706 9:90635444-90635466 AAAAATGCAATGATAATGTTAGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058171226 9:101683486-101683508 GAAAATCCACAGATGTTTTATGG + Intronic
1058672996 9:107376502-107376524 GAAAATACAGAGATATTTTGAGG + Intergenic
1059771962 9:117435033-117435055 GAAAATACAAATGTATTGTTAGG + Intergenic
1060168197 9:121437939-121437961 GAACATGAACAGACATTTTTTGG + Intergenic
1061531110 9:131213942-131213964 GAAAAGGGACAGATCATGTTGGG + Intronic
1187651849 X:21418490-21418512 GAAATTCCACAGCTTTTGTTTGG + Intronic
1187770499 X:22690624-22690646 GAAAATGCATATATGTTGTCAGG + Intergenic
1187782207 X:22839464-22839486 AAATATGCACCGATATGGTTTGG - Intergenic
1188153883 X:26716762-26716784 GAACATGCACATCTATTGTGAGG - Intergenic
1188169720 X:26910065-26910087 GAAAAAGCACAGATATAGAGAGG + Intergenic
1188754088 X:33938954-33938976 GTAAATCCACTGATATAGTTTGG + Intergenic
1193592160 X:83403055-83403077 GAACATGTACATATATTATTTGG - Intergenic
1193614403 X:83670388-83670410 GAAAATTAACTGATATGGTTTGG + Intergenic
1194041046 X:88942386-88942408 GTAAATGGACAGAAATTGCTGGG - Intergenic
1194140331 X:90201564-90201586 GAAAATTCACTGATTTTTTTTGG + Intergenic
1194227562 X:91279882-91279904 GAAACTGCAGAGATATTACTAGG - Intergenic
1194288837 X:92043000-92043022 GAAAATGCACAGCTATTTTTAGG - Intronic
1194634623 X:96329495-96329517 GAAAATGAACAAATAATATTGGG - Intergenic
1195266808 X:103189376-103189398 GAGAATGTACAGAGAATGTTTGG + Intergenic
1197823394 X:130563983-130564005 AAAAATGCAGAGATATTGGGAGG + Intergenic
1199210622 X:145205916-145205938 GAAAGAGCACAGAAATTGTGAGG + Intergenic
1199748986 X:150796534-150796556 GCAAATGCACATTTATAGTTGGG + Intronic
1200270158 X:154675028-154675050 GAAAATGACAAGATATGGTTTGG + Intergenic
1200606357 Y:5267567-5267589 GAAAATGCACAGCTATTTTTAGG - Intronic