ID: 943889706

View in Genome Browser
Species Human (GRCh38)
Location 2:193271278-193271300
Sequence CCAACCTGTTAGAACAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943889706_943889709 9 Left 943889706 2:193271278-193271300 CCATGGCTGTTCTAACAGGTTGG No data
Right 943889709 2:193271310-193271332 CTTGCAGCTTTTCCAGGTTCAGG No data
943889706_943889710 10 Left 943889706 2:193271278-193271300 CCATGGCTGTTCTAACAGGTTGG No data
Right 943889710 2:193271311-193271333 TTGCAGCTTTTCCAGGTTCAGGG No data
943889706_943889708 3 Left 943889706 2:193271278-193271300 CCATGGCTGTTCTAACAGGTTGG No data
Right 943889708 2:193271304-193271326 TGAGTGCTTGCAGCTTTTCCAGG 0: 18
1: 220
2: 920
3: 1274
4: 2080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943889706 Original CRISPR CCAACCTGTTAGAACAGCCA TGG (reversed) Intergenic
No off target data available for this crispr