ID: 943890017

View in Genome Browser
Species Human (GRCh38)
Location 2:193275227-193275249
Sequence ACTGCTTTGCAGGTAGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943890014_943890017 -3 Left 943890014 2:193275207-193275229 CCAAATCTGTCTAAGGTGAGACT No data
Right 943890017 2:193275227-193275249 ACTGCTTTGCAGGTAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943890017 Original CRISPR ACTGCTTTGCAGGTAGTGAA GGG Intergenic
No off target data available for this crispr