ID: 943890484

View in Genome Browser
Species Human (GRCh38)
Location 2:193279674-193279696
Sequence CCTTCCAACAATGATTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943890477_943890484 1 Left 943890477 2:193279650-193279672 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG No data
943890475_943890484 23 Left 943890475 2:193279628-193279650 CCGTACCTTAATAGCTCTTCTTC No data
Right 943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG No data
943890478_943890484 -3 Left 943890478 2:193279654-193279676 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG No data
943890476_943890484 18 Left 943890476 2:193279633-193279655 CCTTAATAGCTCTTCTTCCTTCC No data
Right 943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG No data
943890479_943890484 -7 Left 943890479 2:193279658-193279680 CCTTCCTTCCTTCCTTCCTTCCA 0: 294
1: 36937
2: 29377
3: 37324
4: 63997
Right 943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG No data
943890474_943890484 26 Left 943890474 2:193279625-193279647 CCACCGTACCTTAATAGCTCTTC No data
Right 943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943890484 Original CRISPR CCTTCCAACAATGATTTATT TGG Intergenic
No off target data available for this crispr