ID: 943897135

View in Genome Browser
Species Human (GRCh38)
Location 2:193378489-193378511
Sequence CTTCACCTGCAGAAGATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943897127_943897135 16 Left 943897127 2:193378450-193378472 CCCATCTGTGCCAGTAAATTTCA No data
Right 943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG No data
943897128_943897135 15 Left 943897128 2:193378451-193378473 CCATCTGTGCCAGTAAATTTCAA No data
Right 943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG No data
943897126_943897135 22 Left 943897126 2:193378444-193378466 CCTTAACCCATCTGTGCCAGTAA No data
Right 943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG No data
943897131_943897135 6 Left 943897131 2:193378460-193378482 CCAGTAAATTTCAATAAGGGAGC No data
Right 943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943897135 Original CRISPR CTTCACCTGCAGAAGATGTA AGG Intergenic
No off target data available for this crispr