ID: 943904182

View in Genome Browser
Species Human (GRCh38)
Location 2:193476393-193476415
Sequence AGTACTTAGGCACCCCAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943904173_943904182 -5 Left 943904173 2:193476375-193476397 CCCCCCTTTAAACCCATCAGTAC No data
Right 943904182 2:193476393-193476415 AGTACTTAGGCACCCCAAGGCGG No data
943904174_943904182 -6 Left 943904174 2:193476376-193476398 CCCCCTTTAAACCCATCAGTACT No data
Right 943904182 2:193476393-193476415 AGTACTTAGGCACCCCAAGGCGG No data
943904175_943904182 -7 Left 943904175 2:193476377-193476399 CCCCTTTAAACCCATCAGTACTT No data
Right 943904182 2:193476393-193476415 AGTACTTAGGCACCCCAAGGCGG No data
943904177_943904182 -9 Left 943904177 2:193476379-193476401 CCTTTAAACCCATCAGTACTTAG No data
Right 943904182 2:193476393-193476415 AGTACTTAGGCACCCCAAGGCGG No data
943904176_943904182 -8 Left 943904176 2:193476378-193476400 CCCTTTAAACCCATCAGTACTTA No data
Right 943904182 2:193476393-193476415 AGTACTTAGGCACCCCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943904182 Original CRISPR AGTACTTAGGCACCCCAAGG CGG Intergenic
No off target data available for this crispr