ID: 943904368

View in Genome Browser
Species Human (GRCh38)
Location 2:193478746-193478768
Sequence TACATTATGAGGATCAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943904363_943904368 3 Left 943904363 2:193478720-193478742 CCTGTTAGAAAAAGTATAACACT No data
Right 943904368 2:193478746-193478768 TACATTATGAGGATCAGGGGAGG No data
943904362_943904368 20 Left 943904362 2:193478703-193478725 CCTTCAACAACATGACTCCTGTT No data
Right 943904368 2:193478746-193478768 TACATTATGAGGATCAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943904368 Original CRISPR TACATTATGAGGATCAGGGG AGG Intergenic
No off target data available for this crispr