ID: 943928548

View in Genome Browser
Species Human (GRCh38)
Location 2:193819925-193819947
Sequence GGTGCTGTTGCAACACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943928548_943928554 28 Left 943928548 2:193819925-193819947 CCTGGTTGTGTTGCAACAGCACC No data
Right 943928554 2:193819976-193819998 TTGGAGCAGAAGCTGCATGCAGG No data
943928548_943928555 29 Left 943928548 2:193819925-193819947 CCTGGTTGTGTTGCAACAGCACC No data
Right 943928555 2:193819977-193819999 TGGAGCAGAAGCTGCATGCAGGG No data
943928548_943928552 9 Left 943928548 2:193819925-193819947 CCTGGTTGTGTTGCAACAGCACC No data
Right 943928552 2:193819957-193819979 CTCCAACTTTGCTCTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943928548 Original CRISPR GGTGCTGTTGCAACACAACC AGG (reversed) Intergenic
No off target data available for this crispr