ID: 943928552

View in Genome Browser
Species Human (GRCh38)
Location 2:193819957-193819979
Sequence CTCCAACTTTGCTCTGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943928547_943928552 24 Left 943928547 2:193819910-193819932 CCAAACATGCTCACACCTGGTTG No data
Right 943928552 2:193819957-193819979 CTCCAACTTTGCTCTGAAATTGG No data
943928546_943928552 25 Left 943928546 2:193819909-193819931 CCCAAACATGCTCACACCTGGTT No data
Right 943928552 2:193819957-193819979 CTCCAACTTTGCTCTGAAATTGG No data
943928548_943928552 9 Left 943928548 2:193819925-193819947 CCTGGTTGTGTTGCAACAGCACC No data
Right 943928552 2:193819957-193819979 CTCCAACTTTGCTCTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943928552 Original CRISPR CTCCAACTTTGCTCTGAAAT TGG Intergenic
No off target data available for this crispr