ID: 943928554

View in Genome Browser
Species Human (GRCh38)
Location 2:193819976-193819998
Sequence TTGGAGCAGAAGCTGCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943928548_943928554 28 Left 943928548 2:193819925-193819947 CCTGGTTGTGTTGCAACAGCACC No data
Right 943928554 2:193819976-193819998 TTGGAGCAGAAGCTGCATGCAGG No data
943928551_943928554 7 Left 943928551 2:193819946-193819968 CCTGGGCTCGACTCCAACTTTGC No data
Right 943928554 2:193819976-193819998 TTGGAGCAGAAGCTGCATGCAGG No data
943928553_943928554 -6 Left 943928553 2:193819959-193819981 CCAACTTTGCTCTGAAATTGGAG No data
Right 943928554 2:193819976-193819998 TTGGAGCAGAAGCTGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943928554 Original CRISPR TTGGAGCAGAAGCTGCATGC AGG Intergenic
No off target data available for this crispr