ID: 943930515

View in Genome Browser
Species Human (GRCh38)
Location 2:193845444-193845466
Sequence AGTGATCCCAAAGAATGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943930515_943930517 -1 Left 943930515 2:193845444-193845466 CCAGTACATTCTTTGGGATCACT No data
Right 943930517 2:193845466-193845488 TTGTAAAATATAAAACTGGTAGG No data
943930515_943930516 -5 Left 943930515 2:193845444-193845466 CCAGTACATTCTTTGGGATCACT No data
Right 943930516 2:193845462-193845484 TCACTTGTAAAATATAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943930515 Original CRISPR AGTGATCCCAAAGAATGTAC TGG (reversed) Intergenic