ID: 943930515 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:193845444-193845466 |
| Sequence | AGTGATCCCAAAGAATGTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943930515_943930516 | -5 | Left | 943930515 | 2:193845444-193845466 | CCAGTACATTCTTTGGGATCACT | No data | ||
| Right | 943930516 | 2:193845462-193845484 | TCACTTGTAAAATATAAAACTGG | 0: 1 1: 0 2: 3 3: 41 4: 461 |
||||
| 943930515_943930517 | -1 | Left | 943930515 | 2:193845444-193845466 | CCAGTACATTCTTTGGGATCACT | No data | ||
| Right | 943930517 | 2:193845466-193845488 | TTGTAAAATATAAAACTGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943930515 | Original CRISPR | AGTGATCCCAAAGAATGTAC TGG (reversed) | Intergenic | ||